rs768712577

Variant names:

• chr9-128190776-GCTGCTGGAGCTGCTGCTGCTGTAA-G
• rs768712577
• NM_001131016.2:c.58_81delTTACAGCAGCAGCAGCTCCAGCAG

Your query was ambiguous. Multiple possible variants found:

• chr9-128190776-GCTGCTGGAGCTGCTGCTGCTGTAA-G
• chr9-128190776-GCTGCTGGAGCTGCTGCTGCTGTAA-GCTGCTGGAGCTGCTGCTGCTGTAACTGCTGGAGCTGCTGCTGCTGTAA
• chr9-128190776-GCTGCTGGAGCTGCTGCTGCTGTAA-GCTGCTGGAGCTGCTGCTGCTGTAACTGCTGGAGCTGCTGCTGCTGTAACTGCTGGAGCTGCTGCTGCTGTAA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001131016.2(CIZ1):​c.58_81delTTACAGCAGCAGCAGCTCCAGCAG​(p.Leu20_Gln27del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000305 in 1,539,472 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 31)
  • Exomes 𝑓: 0.000030 (0 hom.)
• Consequence: CIZ1 NM_001131016.2 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 3.30
• Publications: 0 publications found

Genes affected

CIZ1 (HGNC:16744): (CDKN1A interacting zinc finger protein 1) The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

CIZ1 Gene-Disease associations (from GenCC):

• dystonia 23

  Inheritance: Unknown Classification: MODERATE Submitted by: Genomics England PanelApp
• inherited dystonia

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001131016.2
• BS2: High AC in GnomAd4 at 5 AD,Unknown gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001131016.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CIZ1	NM_001131016.2	MANE Select	c.58_81delTTACAGCAGCAGCAGCTCCAGCAG	p.Leu20_Gln27del	conservative_inframe_deletion	Exon 2 of 17	NP_001124488.1	Q9ULV3-1
	CIZ1	NM_001257975.2		c.148_171delTTACAGCAGCAGCAGCTCCAGCAG	p.Leu50_Gln57del	conservative_inframe_deletion	Exon 2 of 18	NP_001244904.1	F5H2X7
	CIZ1	NM_012127.3		c.58_81delTTACAGCAGCAGCAGCTCCAGCAG	p.Leu20_Gln27del	conservative_inframe_deletion	Exon 2 of 17	NP_036259.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CIZ1	ENST00000372938.10	TSL:1 MANE Select	c.58_81delTTACAGCAGCAGCAGCTCCAGCAG	p.Leu20_Gln27del	conservative_inframe_deletion	Exon 2 of 17	ENSP00000362029.5	Q9ULV3-1
	CIZ1	ENST00000372954.5	TSL:1	c.58_81delTTACAGCAGCAGCAGCTCCAGCAG	p.Leu20_Gln27del	conservative_inframe_deletion	Exon 2 of 17	ENSP00000362045.1	Q9ULV3-3
	CIZ1	ENST00000538431.5	TSL:2	c.148_171delTTACAGCAGCAGCAGCTCCAGCAG	p.Leu50_Gln57del	conservative_inframe_deletion	Exon 2 of 18	ENSP00000439244.2	F5H2X7

Frequencies

GnomAD3 genomes AF: 0.0000329 AC: 5 AN: 151978 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.0000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000656

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.000479

GnomAD2 exomes AF: 0.0000403 AC: 6 AN: 148858 AF XY: 0.0000380

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000812

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0000881

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000349

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000303 AC: 42 AN: 1387494 Hom.: 0 AF XY: 0.0000380 AC XY: 26 AN XY: 684860

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 31474

American (AMR) AF: 0.0000843 AC: 3 AN: 35604

Ashkenazi Jewish (ASJ) AF: 0.0000399 AC: 1 AN: 25086

East Asian (EAS) AF: 0.0000559 AC: 2 AN: 35770

South Asian (SAS) AF: 0.0000379 AC: 3 AN: 79128

European-Finnish (FIN) AF: 0.0000454 AC: 2 AN: 44046

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5072

European-Non Finnish (NFE) AF: 0.0000242 AC: 26 AN: 1073614

Other (OTH) AF: 0.0000867 AC: 5 AN: 57700

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000000000000333067), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000329 AC: 5 AN: 151978 Hom.: 0 Cov.: 31 AF XY: 0.0000135 AC XY: 1 AN XY: 74210

African (AFR) AF: 0.0000242 AC: 1 AN: 41390

American (AMR) AF: 0.0000656 AC: 1 AN: 15244

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5174

South Asian (SAS) AF: 0.00 AC: 0 AN: 4812

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 67962

Other (OTH) AF: 0.000479 AC: 1 AN: 2086

Alfa AF: 0.0000434 Hom.: 0

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Dystonic disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.3
Mutation Taster		=135/65	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs768712577; hg19: chr9-130953055;