chr9-95447348-CGGGGCTGCTGGCCTTGCCGTCCGGGAGGCAGGGACCCTGAGTCCAGGT-C

Variant names:

• chr9-95447348-CGGGGCTGCTGGCCTTGCCGTCCGGGAGGCAGGGACCCTGAGTCCAGGT-C
• rs1064792957
• NM_000264.5:c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4 BP6

The NM_000264.5(PTCH1):​c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC​(p.His1287_Pro1302del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000684 in 1,461,168 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. H1287H) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000068 (0 hom.)
• Consequence: PTCH1 NM_000264.5 disruptive_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:1
• Conservation: PhyloP100: 4.20
• Publications: 0 publications found

Genes affected

PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]

PTCH1 Gene-Disease associations (from GenCC):

• basal cell nevus syndrome 1

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• holoprosencephaly 7

  Inheritance: AD Classification: DEFINITIVE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
• nevoid basal cell carcinoma syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
• holoprosencephaly

  Inheritance: AD Classification: LIMITED Submitted by: Illumina

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000264.5.
• BP6: Variant 9-95447348-CGGGGCTGCTGGCCTTGCCGTCCGGGAGGCAGGGACCCTGAGTCCAGGT-C is Benign according to our data. Variant chr9-95447348-CGGGGCTGCTGGCCTTGCCGTCCGGGAGGCAGGGACCCTGAGTCCAGGT-C is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 409164.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000264.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTCH1	NM_000264.5	MANE Select	c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1287_Pro1302del	disruptive_inframe_deletion	Exon 23 of 24	NP_000255.2
	PTCH1	NM_001083603.3	MANE Plus Clinical	c.3857_3904delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1286_Pro1301del	disruptive_inframe_deletion	Exon 23 of 24	NP_001077072.1
	PTCH1	NM_001354918.2		c.3704_3751delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1235_Pro1250del	disruptive_inframe_deletion	Exon 22 of 23	NP_001341847.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PTCH1	ENST00000331920.11	TSL:5 MANE Select	c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1287_Pro1302del	disruptive_inframe_deletion	Exon 23 of 24	ENSP00000332353.6
	PTCH1	ENST00000437951.6	TSL:5 MANE Plus Clinical	c.3857_3904delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1286_Pro1301del	disruptive_inframe_deletion	Exon 23 of 24	ENSP00000389744.2
	PTCH1	ENST00000429896.6	TSL:1	c.3407_3454delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1136_Pro1151del	disruptive_inframe_deletion	Exon 23 of 24	ENSP00000414823.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000684 AC: 10 AN: 1461168 Hom.: 0 AF XY: 0.00000963 AC XY: 7 AN XY: 726904

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000299 AC: 1 AN: 33476

American (AMR) AF: 0.00 AC: 0 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26130

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.0000116 AC: 1 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52822

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5758

European-Non Finnish (NFE) AF: 0.00000719 AC: 8 AN: 1111934

Other (OTH) AF: 0.00 AC: 0 AN: 60376

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	Gorlin syndrome (1)
-	-	1	Hereditary cancer-predisposing syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792957; hg19: chr9-98209630;