chr9-95447348-CGGGGCTGCTGGCCTTGCCGTCCGGGAGGCAGGGACCCTGAGTCCAGGT-C
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4BP6
The NM_000264.5(PTCH1):c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC(p.His1287_Pro1302del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000684 in 1,461,168 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. There is a variant allele frequency bias in the population database for this variant (GnomAdExome4), which may indicate mosaicism or somatic mutations in the reference population data. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. H1287H) has been classified as Likely benign.
Frequency
Consequence
NM_000264.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- basal cell nevus syndrome 1Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
- holoprosencephaly 7Inheritance: AD Classification: DEFINITIVE, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- nevoid basal cell carcinoma syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae), Orphanet
- holoprosencephalyInheritance: AD Classification: LIMITED Submitted by: Illumina
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000264.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PTCH1 | NM_000264.5 | MANE Select | c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC | p.His1287_Pro1302del | disruptive_inframe_deletion | Exon 23 of 24 | NP_000255.2 | ||
| PTCH1 | NM_001083603.3 | MANE Plus Clinical | c.3857_3904delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC | p.His1286_Pro1301del | disruptive_inframe_deletion | Exon 23 of 24 | NP_001077072.1 | ||
| PTCH1 | NM_001354918.2 | c.3704_3751delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC | p.His1235_Pro1250del | disruptive_inframe_deletion | Exon 22 of 23 | NP_001341847.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PTCH1 | ENST00000331920.11 | TSL:5 MANE Select | c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC | p.His1287_Pro1302del | disruptive_inframe_deletion | Exon 23 of 24 | ENSP00000332353.6 | ||
| PTCH1 | ENST00000437951.6 | TSL:5 MANE Plus Clinical | c.3857_3904delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC | p.His1286_Pro1301del | disruptive_inframe_deletion | Exon 23 of 24 | ENSP00000389744.2 | ||
| PTCH1 | ENST00000429896.6 | TSL:1 | c.3407_3454delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC | p.His1136_Pro1151del | disruptive_inframe_deletion | Exon 23 of 24 | ENSP00000414823.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.00000684 AC: 10AN: 1461168Hom.: 0 AF XY: 0.00000963 AC XY: 7AN XY: 726904 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 32
ClinVar
ClinVar submissions as Germline
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at