rs1064792957

Positions:

• chr9-95447348-CGGGGCTGCTGGCCTTGCCGTCCGGGAGGCAGGGACCCTGAGTCCAGGT-C

Variant summary

Our verdict is Likely benign. Variant got -2 ACMG points: 2P and 4B. PM4 BS2

The NM_000264.5(PTCH1):​c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC​(p.His1287_Pro1302del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000684 in 1,461,168 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000068 (0 hom.)
• Consequence: PTCH1 NM_000264.5 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 4.20

Genes affected

PTCH1 (HGNC:9585): (patched 1) This gene encodes a member of the patched family of proteins and a component of the hedgehog signaling pathway. Hedgehog signaling is important in embryonic development and tumorigenesis. The encoded protein is the receptor for the secreted hedgehog ligands, which include sonic hedgehog, indian hedgehog and desert hedgehog. Following binding by one of the hedgehog ligands, the encoded protein is trafficked away from the primary cilium, relieving inhibition of the G-protein-coupled receptor smoothened, which results in activation of downstream signaling. Mutations of this gene have been associated with basal cell nevus syndrome and holoprosencephaly. [provided by RefSeq, Aug 2017]

PTCH1 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000264.5.
• BS2: High AC in GnomAdExome4 at 10 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PTCH1	NM_000264.5	c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1287_Pro1302del	disruptive_inframe_deletion	23/24	ENST00000331920.11	NP_000255.2
PTCH1	NM_001083603.3	c.3857_3904delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1286_Pro1301del	disruptive_inframe_deletion	23/24	ENST00000437951.6	NP_001077072.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PTCH1	ENST00000331920.11	c.3860_3907delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1287_Pro1302del	disruptive_inframe_deletion	23/24	5	NM_000264.5	ENSP00000332353.6
PTCH1	ENST00000437951.6	c.3857_3904delACCTGGACTCAGGGTCCCTGCCTCCCGGACGGCAAGGCCAGCAGCCCC	p.His1286_Pro1301del	disruptive_inframe_deletion	23/24	5	NM_001083603.3	ENSP00000389744.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000684 AC: 10 AN: 1461168 Hom.: 0 AF XY: 0.00000963 AC XY: 7 AN XY: 726904

Gnomad4 AFR exome AF: 0.0000299

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000116

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000719

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Gorlin syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Oct 06, 2023

This variant, c.3860_3907del, results in the deletion of 16 amino acid(s) of the PTCH1 protein (p.His1287_Pro1302del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PTCH1-related conditions. ClinVar contains an entry for this variant (Variation ID: 409164). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

May 31, 2024

The c.3860_3907del48 variant (also known as p.H1287_P1302del) is located in coding exon 23 of the PTCH1 gene. This variant results from an in-frame 48 nucleotide deletion at nucleotide positions 3860 to 3907. This results in the in-frame deletion of 16 amino acid residues at codons 1287 to 1302. This variant has been detected in multiple individuals with no reported features of PTCH1-associated disease (Ambry internal data). This amino acid region is generally not well conserved in available vertebrate species. Based on the available evidence, the clinical significance of this variant remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064792957; hg19: chr9-98209630;