chrX-32343232-GATACCACTGATGAGAAATTTCTAGAGCC-G
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_004006.3(DMD):c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT(p.Lys1871AsnfsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. K1871K) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_004006.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- dilated cardiomyopathy 3BInheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
- Duchenne and Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- Duchenne muscular dystrophyInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- progressive muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- symptomatic form of muscular dystrophy of Duchenne and Becker in female carriersInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004006.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | MANE Select | c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT | p.Lys1871AsnfsTer11 | frameshift | Exon 40 of 79 | NP_003997.2 | P11532-1 | ||
| DMD | c.5601_5628delGGCTCTAGAAATTTCTCATCAGTGGTAT | p.Lys1867AsnfsTer11 | frameshift | Exon 40 of 79 | NP_004000.1 | P11532 | |||
| DMD | c.5589_5616delGGCTCTAGAAATTTCTCATCAGTGGTAT | p.Lys1863AsnfsTer11 | frameshift | Exon 40 of 79 | NP_000100.3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | TSL:1 MANE Select | c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT | p.Lys1871AsnfsTer11 | frameshift | Exon 40 of 79 | ENSP00000354923.3 | P11532-1 | ||
| DMD | TSL:5 | c.5601_5628delGGCTCTAGAAATTTCTCATCAGTGGTAT | p.Lys1867AsnfsTer11 | frameshift | Exon 40 of 79 | ENSP00000367948.2 | P11532-11 | ||
| DMD | TSL:5 | c.1581_1608delGGCTCTAGAAATTTCTCATCAGTGGTAT | p.Lys527AsnfsTer11 | frameshift | Exon 12 of 51 | ENSP00000479270.2 | A0A087WV90 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at