rs1557291170

Variant names:

• chrX-32343232-GATACCACTGATGAGAAATTTCTAGAGCC-G
• rs1557291170
• NM_004006.3:c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_004006.3(DMD):​c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT​(p.Lys1871AsnfsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. K1871K) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 23)
• Consequence: DMD NM_004006.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.65
• Publications: 0 publications found

Genes affected

DMD (HGNC:2928): (dystrophin) This gene spans a genomic range of greater than 2 Mb and encodes a large protein containing an N-terminal actin-binding domain and multiple spectrin repeats. The encoded protein forms a component of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extracellular matrix. Deletions, duplications, and point mutations at this gene locus may cause Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or cardiomyopathy. Alternative promoter usage and alternative splicing result in numerous distinct transcript variants and protein isoforms for this gene. [provided by RefSeq, Dec 2016]

DMD Gene-Disease associations (from GenCC):

• Becker muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
• dilated cardiomyopathy 3B

  Inheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
• Duchenne and Becker muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• Duchenne muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• progressive muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• symptomatic form of muscular dystrophy of Duchenne and Becker in female carriers

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-32343232-GATACCACTGATGAGAAATTTCTAGAGCC-G is Pathogenic according to our data. Variant chrX-32343232-GATACCACTGATGAGAAATTTCTAGAGCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 455913.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004006.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DMD	NM_004006.3	MANE Select	c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT	p.Lys1871AsnfsTer11	frameshift	Exon 40 of 79	NP_003997.2	P11532-1
	DMD	NM_004009.3		c.5601_5628delGGCTCTAGAAATTTCTCATCAGTGGTAT	p.Lys1867AsnfsTer11	frameshift	Exon 40 of 79	NP_004000.1	P11532
	DMD	NM_000109.4		c.5589_5616delGGCTCTAGAAATTTCTCATCAGTGGTAT	p.Lys1863AsnfsTer11	frameshift	Exon 40 of 79	NP_000100.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DMD	ENST00000357033.9	TSL:1 MANE Select	c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT	p.Lys1871AsnfsTer11	frameshift	Exon 40 of 79	ENSP00000354923.3	P11532-1
	DMD	ENST00000378677.6	TSL:5	c.5601_5628delGGCTCTAGAAATTTCTCATCAGTGGTAT	p.Lys1867AsnfsTer11	frameshift	Exon 40 of 79	ENSP00000367948.2	P11532-11
	DMD	ENST00000619831.5	TSL:5	c.1581_1608delGGCTCTAGAAATTTCTCATCAGTGGTAT	p.Lys527AsnfsTer11	frameshift	Exon 12 of 51	ENSP00000479270.2	A0A087WV90

Frequencies

GnomAD3 genomes Cov.: 23

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 23

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Duchenne muscular dystrophy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.6
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1557291170; hg19: chrX-32361349;