chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Position:

• chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -12 ACMG points: 0P and 12B. BP6_Very_Strong BS2

The NM_000044.6(AR):​c.210_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln71_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00077 (0 hom., 5 hem., cov: 0)
  • Exomes 𝑓: 0.00034 (0 hom. 24 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 0.337

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

AR (HGNC:):

ACMG classification

Verdict is Benign. Variant got -12 ACMG points.

• BP6: Variant X-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA is described in ClinVar as [Likely_benign]. Clinvar id is 420189.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Hemizygotes in GnomAd4 at 5 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AR	NM_000044.6	c.210_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln71_Gln80dup	disruptive_inframe_insertion	1/8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.210_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln71_Gln80dup	disruptive_inframe_insertion	1/8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.000750 AC: 50 AN: 66636 Hom.: 0 Cov.: 0 AF XY: 0.000606 AC XY: 5 AN XY: 8246

Gnomad AFR AF: 0.000373

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000383

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00162

Gnomad SAS AF: 0.00110

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00107

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000343 AC: 321 AN: 937045 Hom.: 0 Cov.: 40 AF XY: 0.0000813 AC XY: 24 AN XY: 295187

Gnomad4 AFR exome AF: 0.000168

Gnomad4 AMR exome AF: 0.000967

Gnomad4 ASJ exome AF: 0.000369

Gnomad4 EAS exome AF: 0.00166

Gnomad4 SAS exome AF: 0.000487

Gnomad4 FIN exome AF: 0.000442

Gnomad4 NFE exome AF: 0.000256

Gnomad4 OTH exome AF: 0.000351

GnomAD4 genome AF: 0.000766 AC: 51 AN: 66623 Hom.: 0 Cov.: 0 AF XY: 0.000605 AC XY: 5 AN XY: 8259

Gnomad4 AFR AF: 0.000372

Gnomad4 AMR AF: 0.000382

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00163

Gnomad4 SAS AF: 0.00111

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00109

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:2

Likely benign, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Jun 01, 2024	AR: BS2 -
Likely benign, criteria provided, single submitter	clinical testing	GeneDx	Jul 24, 2019	This variant is associated with the following publications: (PMID: 2062380) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;