chrX-71223862-T-TCTGCAACACACTCCAGCCTGG
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1PM4
The NM_000166.6(GJB1):c.164_184dupCACTCCAGCCTGGCTGCAACA(p.Thr55_Asn61dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000166.6 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Charcot-Marie-Tooth disease X-linked dominant 1Inheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, PanelApp Australia, ClinGen, Labcorp Genetics (formerly Invitae)
- X-linked progressive cerebellar ataxiaInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| GJB1 | NM_000166.6 | c.164_184dupCACTCCAGCCTGGCTGCAACA | p.Thr55_Asn61dup | disruptive_inframe_insertion | Exon 2 of 2 | ENST00000361726.7 | NP_000157.1 | |
| GJB1 | NM_001097642.3 | c.164_184dupCACTCCAGCCTGGCTGCAACA | p.Thr55_Asn61dup | disruptive_inframe_insertion | Exon 2 of 2 | NP_001091111.1 | ||
| GJB1 | NM_001440770.1 | c.164_184dupCACTCCAGCCTGGCTGCAACA | p.Thr55_Asn61dup | disruptive_inframe_insertion | Exon 3 of 3 | NP_001427699.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| GJB1 | ENST00000361726.7 | c.164_184dupCACTCCAGCCTGGCTGCAACA | p.Thr55_Asn61dup | disruptive_inframe_insertion | Exon 2 of 2 | 1 | NM_000166.6 | ENSP00000354900.6 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 exome Cov.: 31
GnomAD4 genome Cov.: 23
ClinVar
Submissions by phenotype
Charcot-Marie-Tooth disease X-linked dominant 1 Pathogenic:1
- -
Charcot-Marie-Tooth Neuropathy X Uncertain:1
Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may alter RNA splicing, but this prediction has not been confirmed by published transcriptional studies. In summary, this is a novel in-frame duplication with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. This sequence change inserts 21 nucleotides in exon 2 of the GJB1 mRNA (c.164_184dupCACTCCAGCCTGGCTGCAACA). This leads to the insertion of 7 amino acid residues in the GJB1 protein (p.Thr55_Asn61dup) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a GJB1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at