rs1555937071

Variant names:

• chrX-71223862-T-TCTGCAACACACTCCAGCCTGG
• rs1555937071
• NM_000166.6:c.164_184dupCACTCCAGCCTGGCTGCAACA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_000166.6(GJB1):​c.164_184dupCACTCCAGCCTGGCTGCAACA​(p.Thr55_Asn61dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 23)
• Consequence: GJB1 NM_000166.6 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter P:1 U:1
• Conservation: PhyloP100: 1.04
• Publications: 1 publications found

Genes affected

GJB1 (HGNC:4283): (gap junction protein beta 1) This gene encodes a member of the gap junction protein family. The gap junction proteins are membrane-spanning proteins that assemble to form gap junction channels that facilitate the transfer of ions and small molecules between cells. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2008]

GJB1 Gene-Disease associations (from GenCC):

• Charcot-Marie-Tooth disease X-linked dominant 1

  Inheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, PanelApp Australia, ClinGen, Labcorp Genetics (formerly Invitae)
• X-linked progressive cerebellar ataxia

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 15 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 23 uncertain in NM_000166.6
• PM4: Nonframeshift variant in NON repetitive region in NM_000166.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GJB1	NM_000166.6	c.164_184dupCACTCCAGCCTGGCTGCAACA	p.Thr55_Asn61dup	disruptive_inframe_insertion	Exon 2 of 2	ENST00000361726.7	NP_000157.1
GJB1	NM_001097642.3	c.164_184dupCACTCCAGCCTGGCTGCAACA	p.Thr55_Asn61dup	disruptive_inframe_insertion	Exon 2 of 2		NP_001091111.1
GJB1	NM_001440770.1	c.164_184dupCACTCCAGCCTGGCTGCAACA	p.Thr55_Asn61dup	disruptive_inframe_insertion	Exon 3 of 3		NP_001427699.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GJB1	ENST00000361726.7	c.164_184dupCACTCCAGCCTGGCTGCAACA	p.Thr55_Asn61dup	disruptive_inframe_insertion	Exon 2 of 2	1	NM_000166.6	ENSP00000354900.6

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 23

ClinVar

Significance: Uncertain significance

Submissions summary: Pathogenic:1 Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Charcot-Marie-Tooth disease X-linked dominant 1 Pathogenic:1

Sep 24, 2002

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Charcot-Marie-Tooth Neuropathy X Uncertain:1

Apr 26, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may alter RNA splicing, but this prediction has not been confirmed by published transcriptional studies. In summary, this is a novel in-frame duplication with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. This sequence change inserts 21 nucleotides in exon 2 of the GJB1 mRNA (c.164_184dupCACTCCAGCCTGGCTGCAACA). This leads to the insertion of 7 amino acid residues in the GJB1 protein (p.Thr55_Asn61dup) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a GJB1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555937071; hg19: chrX-70443712;