rs1064792934

Variant names:

• chr9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT
• rs1064792934
• NM_001114753.3:c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001114753.3(ENG):​c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG​(p.Thr344TrpfsTer7) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T343T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 30)
• Consequence: ENG NM_001114753.3 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 4.21
• Publications: 0 publications found

Genes affected

ENG (HGNC:3349): (endoglin) This gene encodes a homodimeric transmembrane protein which is a major glycoprotein of the vascular endothelium. This protein is a component of the transforming growth factor beta receptor complex and it binds to the beta1 and beta3 peptides with high affinity. Mutations in this gene cause hereditary hemorrhagic telangiectasia, also known as Osler-Rendu-Weber syndrome 1, an autosomal dominant multisystemic vascular dysplasia. This gene may also be involved in preeclampsia and several types of cancer. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]

ENG Gene-Disease associations (from GenCC):

• telangiectasia, hereditary hemorrhagic, type 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• hereditary hemorrhagic telangiectasia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• juvenile polyposis syndrome

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT is Pathogenic according to our data. Variant chr9-127824378-GCTCCGGGCTACAAGTGTCCTTGGGAGGAGTG-CCACCAT is described in ClinVar as Pathogenic. ClinVar VariationId is 407120.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001114753.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENG	NM_001114753.3	MANE Select	c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG	p.Thr344TrpfsTer7	frameshift missense	Exon 8 of 15	NP_001108225.1	P17813-1
	ENG	NM_000118.4		c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG	p.Thr344TrpfsTer7	frameshift missense	Exon 8 of 14	NP_000109.1	Q5T9B9
	ENG	NM_001278138.2		c.483_514delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG	p.Thr162TrpfsTer7	frameshift missense	Exon 8 of 15	NP_001265067.1	F5GX88

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ENG	ENST00000373203.9	TSL:1 MANE Select	c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG	p.Thr344TrpfsTer7	frameshift missense	Exon 8 of 15	ENSP00000362299.4	P17813-1
	ENG	ENST00000344849.5	TSL:1	c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG	p.Thr344TrpfsTer7	frameshift missense	Exon 8 of 14	ENSP00000341917.3	P17813-2
	ENG	ENST00000714047.1		c.1029_1060delCACTCCTCCCAAGGACACTTGTAGCCCGGAGCinsATGGTGG	p.Thr344TrpfsTer7	frameshift missense	Exon 8 of 15	ENSP00000519338.1	A0AAQ5BHC4

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Hereditary hemorrhagic telangiectasia (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792934; hg19: chr9-130586657;