rs1279199437

Variant names:

• chr5-132369842-ACCCTCCGCGGACGGTCTTGGGTCGCCTG-A
• rs1279199437
• NM_003060.4:c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_003060.4(SLC22A5):​c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000132 in 151,940 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: 𝑓 0.000013 (0 hom., cov: 33)
• Consequence: SLC22A5 NM_003060.4 5_prime_UTR
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 1.88
• Publications: 0 publications found

Genes affected

SLC22A5 (HGNC:10969): (solute carrier family 22 member 5) Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]

MIR3936HG (HGNC:40538): (MIR3936 host gene)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003060.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC22A5	NM_003060.4	MANE Select	c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC		5_prime_UTR	Exon 1 of 10	NP_003051.1	O76082-1
	SLC22A5	NM_001308122.2		c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC		5_prime_UTR	Exon 1 of 11	NP_001295051.1	O76082-3
	MIR3936HG	NR_110997.1		n.47_73+1delCAGGCGACCCAAGACCGTCCGCGGAGGG		splice_donor splice_region intron non_coding_transcript_exon	Exon 1 of 8

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC22A5	ENST00000245407.8	TSL:1 MANE Select	c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC		5_prime_UTR	Exon 1 of 10	ENSP00000245407.3	O76082-1
	SLC22A5	ENST00000435065.7	TSL:1	c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC		5_prime_UTR	Exon 1 of 11	ENSP00000402760.2	O76082-3
	SLC22A5	ENST00000448810.6	TSL:1	n.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC		non_coding_transcript_exon	Exon 1 of 10	ENSP00000401860.2	H7C1R8

Frequencies

GnomAD3 genomes AF: 0.0000132 AC: 2 AN: 151940 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000484

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000132 AC: 2 AN: 151940 Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1 AN XY: 74230

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000484 AC: 2 AN: 41346

American (AMR) AF: 0.00 AC: 0 AN: 15278

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5160

South Asian (SAS) AF: 0.00 AC: 0 AN: 4804

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10598

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67974

Other (OTH) AF: 0.00 AC: 0 AN: 2090

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.00233887), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	Renal carnitine transport defect (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1279199437; hg19: chr5-131705534;