rs1279199437
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_003060.4(SLC22A5):c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000132 in 151,940 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).
Frequency
Consequence
NM_003060.4 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003060.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SLC22A5 | NM_003060.4 | MANE Select | c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC | 5_prime_UTR | Exon 1 of 10 | NP_003051.1 | O76082-1 | ||
| SLC22A5 | NM_001308122.2 | c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC | 5_prime_UTR | Exon 1 of 11 | NP_001295051.1 | O76082-3 | |||
| MIR3936HG | NR_110997.1 | n.47_73+1delCAGGCGACCCAAGACCGTCCGCGGAGGG | splice_donor splice_region intron non_coding_transcript_exon | Exon 1 of 8 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SLC22A5 | ENST00000245407.8 | TSL:1 MANE Select | c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC | 5_prime_UTR | Exon 1 of 10 | ENSP00000245407.3 | O76082-1 | ||
| SLC22A5 | ENST00000435065.7 | TSL:1 | c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC | 5_prime_UTR | Exon 1 of 11 | ENSP00000402760.2 | O76082-3 | ||
| SLC22A5 | ENST00000448810.6 | TSL:1 | n.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC | non_coding_transcript_exon | Exon 1 of 10 | ENSP00000401860.2 | H7C1R8 |
Frequencies
GnomAD3 genomes AF: 0.0000132 AC: 2AN: 151940Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 genome AF: 0.0000132 AC: 2AN: 151940Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1AN XY: 74230 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at