rs1553412502

Positions:

• chr2-47799084-T-TGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000179.3(MSH6):​c.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC​(p.His388fs) variant causes a frameshift, stop gained change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. H388H) has been classified as Benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: MSH6 NM_000179.3 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 9.70

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-47799084-T-TGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC is Pathogenic according to our data. Variant chr2-47799084-T-TGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC is described in ClinVar as [Pathogenic]. Clinvar id is 525833.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MSH6	NM_000179.3	c.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC	p.His388fs	frameshift_variant, stop_gained	4/10	ENST00000234420.11	NP_000170.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.1102_1162dupGAAACTTTAGAATGGCTTAAGGAGGAAAAGAGAAGAGATGAGCACAGGAGGAGGCCTGATC	p.His388fs	frameshift_variant, stop_gained	4/10	1	NM_000179.3	ENSP00000234420.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Lynch syndrome 5 Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Myriad Genetics, Inc.

Aug 11, 2023

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jun 23, 2023

ClinVar contains an entry for this variant (Variation ID: 525833). This sequence change creates a premature translational stop signal (p.His388Argfs*7) in the MSH6 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in MSH6 are known to be pathogenic (PMID: 18269114, 24362816). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553412502; hg19: chr2-48026223;