rs1554088199

Variant names:

• chr5-132390903-AGGTAGGGACCATGTGCATCTAT-A
• rs1554088199
• NM_003060.4:c.1267+3_1267+24delAGGGACCATGTGCATCTATGGT

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP3

The NM_003060.4(SLC22A5):​c.1267+3_1267+24delAGGGACCATGTGCATCTATGGT variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: SLC22A5 NM_003060.4 splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:2
• Conservation: PhyloP100: 9.60
• Publications: 0 publications found

Genes affected

SLC22A5 (HGNC:10969): (solute carrier family 22 member 5) Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]

SLC22A5 Gene-Disease associations (from GenCC):

• systemic primary carnitine deficiency disease

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, G2P, Orphanet, PanelApp Australia, Labcorp Genetics (formerly Invitae), Myriad Women’s Health
• short QT syndrome

  Inheritance: AR Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SLC22A5	NM_003060.4	c.1267+3_1267+24delAGGGACCATGTGCATCTATGGT		splice_region_variant, intron_variant	Intron 7 of 9	ENST00000245407.8	NP_003051.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SLC22A5	ENST00000245407.8	c.1267+3_1267+24delAGGGACCATGTGCATCTATGGT		splice_region_variant, intron_variant	Intron 7 of 9	1	NM_003060.4	ENSP00000245407.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, single submitter

Submissions by phenotype

Renal carnitine transport defect Uncertain:2

May 30, 2017

Counsyl

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Sep 01, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change falls in intron 7 of the SLC22A5 gene. It does not directly change the encoded amino acid sequence of the SLC22A5 protein. It affects a nucleotide within the consensus splice site of the intron. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with clinical features of SLC22A5-related disease (PMID: 20574985). ClinVar contains an entry for this variant (Variation ID: 552220). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554088199; hg19: chr5-131726595;