rs1554293869

Variant names:

• chr7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA
• rs1554293869
• NM_152743.4:c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_152743.4(BRAT1):​c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC​(p.Glu515SerfsTer15) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: BRAT1 NM_152743.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.36

Genes affected

BRAT1 (HGNC:21701): (BRCA1 associated ATM activator 1) The protein encoded by this ubiquitously expressed gene interacts with the tumor suppressing BRCA1 (breast cancer 1) protein and and the ATM (ataxia telangiectasia mutated) protein. ATM is thought to be a master controller of cell cycle checkpoint signalling pathways that are required for cellular responses to DNA damage such as double-strand breaks that are induced by ionizing radiation and complexes with BRCA1 in the multi-protein complex BASC (BRAC1-associated genome surveillance complex). The protein encoded by this gene is thought to play a role in the DNA damage pathway regulated by BRCA1 and ATM. [provided by RefSeq, Mar 2012]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA is Pathogenic according to our data. Variant chr7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA is described in ClinVar as [Pathogenic]. Clinvar id is 540176.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BRAT1	NM_152743.4	c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC	p.Glu515SerfsTer15	frameshift_variant, missense_variant	Exon 12 of 14	ENST00000340611.9	NP_689956.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BRAT1	ENST00000340611.9	c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC	p.Glu515SerfsTer15	frameshift_variant, missense_variant	Exon 12 of 14	1	NM_152743.4	ENSP00000339637.4

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Neonatal-onset encephalopathy with rigidity and seizures Pathogenic:1

Nov 24, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Glu515Serfs*15) in the BRAT1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRAT1 are known to be pathogenic (PMID: 22279524, 25500575). Information on the frequency of this variant in the gnomAD database is not available, as this variant may be reported differently in the database. This variant has not been reported in the literature in individuals affected with BRAT1-related conditions. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554293869; hg19: chr7-2579211;