rs1554293869

Variant names:

• chr7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA
• rs1554293869
• NM_152743.4:c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_152743.4(BRAT1):​c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC​(p.Glu515SerfsTer15) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: BRAT1 NM_152743.4 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.36
• Publications: 0 publications found

Genes affected

BRAT1 (HGNC:21701): (BRCA1 associated ATM activator 1) The protein encoded by this ubiquitously expressed gene interacts with the tumor suppressing BRCA1 (breast cancer 1) protein and and the ATM (ataxia telangiectasia mutated) protein. ATM is thought to be a master controller of cell cycle checkpoint signalling pathways that are required for cellular responses to DNA damage such as double-strand breaks that are induced by ionizing radiation and complexes with BRCA1 in the multi-protein complex BASC (BRAC1-associated genome surveillance complex). The protein encoded by this gene is thought to play a role in the DNA damage pathway regulated by BRCA1 and ATM. [provided by RefSeq, Mar 2012]

BRAT1 Gene-Disease associations (from GenCC):

• neonatal-onset encephalopathy with rigidity and seizures

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae), G2P
• neurodevelopmental disorder with cerebellar atrophy and with or without seizures

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA is Pathogenic according to our data. Variant chr7-2539577-CGAGGGCGGAGTCCCTCACCTC-GA is described in ClinVar as Pathogenic. ClinVar VariationId is 540176.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_152743.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRAT1	NM_152743.4	MANE Select	c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC	p.Glu515SerfsTer15	frameshift missense	Exon 12 of 14	NP_689956.2	Q6PJG6-1
	BRAT1	NM_001350626.2		c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC	p.Glu515SerfsTer15	frameshift missense	Exon 12 of 14	NP_001337555.1
	BRAT1	NM_001350627.2		c.1018_1039delGAGGTGAGGGACTCCGCCCTCGinsTC	p.Glu340SerfsTer15	frameshift missense	Exon 11 of 13	NP_001337556.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BRAT1	ENST00000340611.9	TSL:1 MANE Select	c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC	p.Glu515SerfsTer15	frameshift missense	Exon 12 of 14	ENSP00000339637.4	Q6PJG6-1
	BRAT1	ENST00000890463.1		c.1780_1801delGAGGTGAGGGACTCCGCCCTCGinsTC	p.Glu594SerfsTer15	frameshift missense	Exon 14 of 16	ENSP00000560522.1
	BRAT1	ENST00000917322.1		c.1777_1798delGAGGTGAGGGACTCCGCCCTCGinsTC	p.Glu593SerfsTer15	frameshift missense	Exon 14 of 16	ENSP00000587381.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Neonatal-onset encephalopathy with rigidity and seizures (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554293869; hg19: chr7-2579211;