rs1554481768

Variant names:

• chr7-70766228-AGCACCAGCACCAGCACACCCACCAGCACAC-A
• rs1554481768
• NM_015570.4:c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 3P and 1B. PM1 PP3 BP3

The NM_015570.4(AUTS2):​c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC​(p.Gln532_His541del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: AUTS2 NM_015570.4 conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.88
• Publications: 0 publications found

Genes affected

AUTS2 (HGNC:14262): (activator of transcription and developmental regulator AUTS2) This gene has been implicated in neurodevelopment and as a candidate gene for numerous neurological disorders, including autism spectrum disorders, intellectual disability, and developmental delay. Mutations in this gene have also been associated with non-neurological disorders, such as acute lymphoblastic leukemia, aging of the skin, early-onset androgenetic alopecia, and certain cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2014]

AUTS2 Gene-Disease associations (from GenCC):

• autism spectrum disorder due to AUTS2 deficiency

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P
• syndromic intellectual disability

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 6 uncertain in NM_015570.4
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• BP3: Nonframeshift variant in repetitive region in NM_015570.4

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_015570.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AUTS2	NM_015570.4	MANE Select	c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC	p.Gln532_His541del	conservative_inframe_deletion	Exon 9 of 19	NP_056385.1	Q8WXX7-1
	AUTS2	NM_001127231.3		c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC	p.Gln532_His541del	conservative_inframe_deletion	Exon 9 of 18	NP_001120703.1	Q8WXX7-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AUTS2	ENST00000342771.10	TSL:1 MANE Select	c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC	p.Gln532_His541del	conservative_inframe_deletion	Exon 9 of 19	ENSP00000344087.4	Q8WXX7-1
	AUTS2	ENST00000406775.6	TSL:1	c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC	p.Gln532_His541del	conservative_inframe_deletion	Exon 9 of 18	ENSP00000385263.2	Q8WXX7-2
	AUTS2	ENST00000644939.1		c.1591_1620delCAGCACACCCACCAGCACACGCACCAGCAC	p.Gln531_His540del	conservative_inframe_deletion	Exon 9 of 19	ENSP00000496726.1	A0A2R8Y8C6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554481768; hg19: chr7-70231214;