rs1554884966

Variant names:

• chr11-533849-G-GTCCCGCATGGCGCTGTACTCC
• rs1554884966
• NM_005343.4:c.186_206dupGGAGTACAGCGCCATGCGGGA

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP5_Moderate

The NM_005343.4(HRAS):​c.186_206dupGGAGTACAGCGCCATGCGGGA​(p.Glu62_Arg68dup) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: HRAS NM_005343.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.10
• Publications: 1 publications found

Genes affected

HRAS (HGNC:5173): (HRas proto-oncogene, GTPase) This gene belongs to the Ras oncogene family, whose members are related to the transforming genes of mammalian sarcoma retroviruses. The products encoded by these genes function in signal transduction pathways. These proteins can bind GTP and GDP, and they have intrinsic GTPase activity. This protein undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Mutations in this gene cause Costello syndrome, a disease characterized by increased growth at the prenatal stage, growth deficiency at the postnatal stage, predisposition to tumor formation, cognitive disability, skin and musculoskeletal abnormalities, distinctive facial appearance and cardiovascular abnormalities. Defects in this gene are implicated in a variety of cancers, including bladder cancer, follicular thyroid cancer, and oral squamous cell carcinoma. Multiple transcript variants, which encode different isoforms, have been identified for this gene. [provided by RefSeq, Jul 2008]

LRRC56 (HGNC:25430): (leucine rich repeat containing 56) Predicted to be involved in cell projection organization. Predicted to be located in cilium. Implicated in primary ciliary dyskinesia 39. [provided by Alliance of Genome Resources, Apr 2022]

LRRC56 Gene-Disease associations (from GenCC):

• ciliary dyskinesia, primary, 39

  Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 5 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 20 uncertain in NM_005343.4
• PM4: Nonframeshift variant in NON repetitive region in NM_005343.4.
• PP5: Variant 11-533849-G-GTCCCGCATGGCGCTGTACTCC is Pathogenic according to our data. Variant chr11-533849-G-GTCCCGCATGGCGCTGTACTCC is described in ClinVar as Pathogenic. ClinVar VariationId is 462149.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HRAS	NM_005343.4	c.186_206dupGGAGTACAGCGCCATGCGGGA	p.Glu62_Arg68dup	disruptive_inframe_insertion	Exon 3 of 6	ENST00000311189.8	NP_005334.1
HRAS	NM_176795.5	c.186_206dupGGAGTACAGCGCCATGCGGGA	p.Glu62_Arg68dup	disruptive_inframe_insertion	Exon 3 of 6	ENST00000417302.7	NP_789765.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HRAS	ENST00000311189.8	c.186_206dupGGAGTACAGCGCCATGCGGGA	p.Glu62_Arg68dup	disruptive_inframe_insertion	Exon 3 of 6	1	NM_005343.4	ENSP00000309845.7
HRAS	ENST00000417302.7	c.186_206dupGGAGTACAGCGCCATGCGGGA	p.Glu62_Arg68dup	disruptive_inframe_insertion	Exon 3 of 6	5	NM_176795.5	ENSP00000388246.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 34

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Costello syndrome Pathogenic:1

Nov 27, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.186_206dup, results in the insertion of 7 amino acid(s) of the HRAS protein (p.Glu62_Arg68dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of RASopathy (PMID: 32499600, 34618388; Invitae). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 462149). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects HRAS function (PMID: 32499600, 34618388). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.1
Mutation Taster		=13/87	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554884966; hg19: chr11-533849;