rs1554918013

Positions:

• chr11-5226795-GCAGCCTAAGGGTGGGAAAATAGACCAATAGGCAG-GTAATCTGAGGGTAGGAAAACAGCCCAAGGGAC

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PVS1_Strong PM2 PP5

The NM_000518.5(HBB):​c.93-30_96delCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA​(p.Arg31_Leu32delinsSer???) variant causes a splice acceptor, splice region, synonymous, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). Synonymous variant affecting the same amino acid position (i.e. R31R) has been classified as Pathogenic.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HBB NM_000518.5 splice_acceptor, splice_region, synonymous, intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:1 U:2
• Conservation: PhyloP100: 7.47

Genes affected

HBB (HGNC:4827): (hemoglobin subunit beta) The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]

HBB (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.5 fraction of the gene. Cryptic splice site detected, with MaxEntScore 9.7, offset of 0 (no position change), new splice context is: ggctgttttcctaccctcAGatt. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-5226796-CAGCCTAAGGGTGGGAAAATAGACCAATAGGCAG-TAATCTGAGGGTAGGAAAACAGCCCAAGGGAC is Pathogenic according to our data. Variant chr11-5226796-CAGCCTAAGGGTGGGAAAATAGACCAATAGGCAG-TAATCTGAGGGTAGGAAAACAGCCCAAGGGAC is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 439168.We mark this variant Likely_pathogenic, oryginal submissions are: {Uncertain_significance=2, Likely_pathogenic=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
HBB	NM_000518.5	c.93-30_96delCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA	p.Arg31_Leu32delinsSer???	splice_acceptor_variant, splice_region_variant, synonymous_variant, intron_variant		ENST00000335295.4	NP_000509.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
HBB	ENST00000335295.4	c.93-30_96delCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA	p.Arg31_Leu32delinsSer???	splice_acceptor_variant, splice_region_variant, synonymous_variant, intron_variant		1	NM_000518.5	ENSP00000333994.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:1 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not specified Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Oct 10, 2022	Variant summary: The variant HBB c.93-30_96delins32 (i.e. c.93-30_96delinsGTCCCTTGGGCTGTTTTCCTACCCTCAGATTA) involves the deletion of 30 intronic nucleotides in intron 1 and the first 4 exonic nucleotides in exon 2 and the subsequent insertion of 32 nucleotides. The inserted nucleotide sequence in this variant is predicted to replace the first 4 nucleotides of exon 2 (GCTG) by a different set of nucleotides (ATTA) leading to an in-frame modification at the protein level. Although all 5 in-silico splice analysis tools predict a minor effect on splicing (i.e. prediction of a new splice acceptor site at the same position as in the reference sequence), the region between c.93-21_93-3 is highly sensitive to point mutations. Other reported variants, such as c.93-21G>A, c.93-15T>G and c.93-3T>G as well as multiple deletion/insertion in this region are considered pathogenic in association with beta-thalassemia. In addition, the possibility of a gene conversion from HBD to HBB limited to this 32 base pair insertion versus a gene fusion between HbD and HbB resulting in Hb-Lepore or another variant hemoglobin cannot be entirely ruled out. The variant was absent from controls in gnomAD (246058 control chromosomes). Thus the available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.93-30_96delins32 in individuals affected with Beta Thalassemia and no experimental evidence demonstrating its impact on protein function have been reported. It has however, been observed in at least 4 patients tested at our laboratory, 3 of whom were carriers of this variant without a second disease causing variant. However, one of these 4 individuals was reportedly affected with a mild-anemia, and is compound heterozygous for this variant and another pathogenic variant in the promoter region of the HBB gene. A ClinVar submission from another clinical diagnostic laboratory (evaluation after 2014) cites the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as uncertain significance. -
Uncertain significance, criteria provided, single submitter	clinical testing	Quest Diagnostics Nichols Institute San Juan Capistrano	Aug 30, 2016	- -

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jan 11, 2024

This variant results in the deletion of part of exon 2 (c.93-30_96delins32) of the HBB gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in HBB are known to be pathogenic (PMID: 23637309). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with HBB-related conditions. ClinVar contains an entry for this variant (Variation ID: 439168). In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554918013; hg19: chr11-5248026;