rs1555288450
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1_ModeratePP5_Very_Strong
The NM_001406720.1(BRCA2):c.8954-13_8974delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT(p.Glu2985_Tyr2992delinsAsp) variant causes a splice acceptor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E2985E) has been classified as Likely benign.
Frequency
Consequence
NM_001406720.1 splice_acceptor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- BRCA2-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- breast-ovarian cancer, familial, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- Fanconi anemia complementation group D1Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
- pancreatic cancer, susceptibility to, 2Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
- sarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- medulloblastomaInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001406720.1. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA2 | MANE Select | c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | p.Ser2998IlefsTer19 | frameshift | Exon 23 of 27 | NP_000050.3 | A0A7P0T9D7 | ||
| BRCA2 | c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | p.Ser2998IlefsTer19 | frameshift | Exon 23 of 27 | NP_001419006.1 | A0A7P0T9D7 | |||
| BRCA2 | c.8896_8929delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | p.Ser2966IlefsTer19 | frameshift | Exon 22 of 26 | NP_001393648.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA2 | TSL:5 MANE Select | c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | p.Ser2998IlefsTer19 | frameshift | Exon 23 of 27 | ENSP00000369497.3 | P51587 | ||
| BRCA2 | TSL:1 | c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | p.Ser2998IlefsTer19 | frameshift | Exon 23 of 27 | ENSP00000439902.1 | P51587 | ||
| BRCA2 | TSL:1 | c.8623_8656delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT | p.Ser2875IlefsTer19 | frameshift | Exon 23 of 27 | ENSP00000499438.2 | A0A590UJI7 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at