rs1555288450

Positions:

• chr13-32379786-ATTCTCTGTTAACAGAAGGAAAGAGATACAGAATT-A

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Moderate PM2 PP5_Moderate

The NM_001406720.1(BRCA2):​c.8954-13_8974delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT​(p.Glu2985_Tyr2992delinsAsp) variant causes a splice acceptor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BRCA2 NM_001406720.1 splice_acceptor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.22

Genes affected

BRCA2 (HGNC:1101): (BRCA2 DNA repair associated) Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The largest exon in both genes is exon 11, which harbors the most important and frequent mutations in breast cancer patients. The BRCA2 gene was found on chromosome 13q12.3 in human. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, May 2020]

BRCA2 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.010973937 fraction of the gene. Cryptic splice site detected, with MaxEntScore 4.6, offset of -21, new splice context is: tatttggcgtccatcatcAGatt. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 13-32379786-ATTCTCTGTTAACAGAAGGAAAGAGATACAGAATT-A is Pathogenic according to our data. Variant chr13-32379786-ATTCTCTGTTAACAGAAGGAAAGAGATACAGAATT-A is described in ClinVar as [Pathogenic]. Clinvar id is 491367.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
BRCA2	NM_000059.4	c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT	p.Ser2998fs	frameshift_variant	23/27	ENST00000380152.8	NP_000050.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
BRCA2	ENST00000380152.8	c.8992_9025delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT	p.Ser2998fs	frameshift_variant	23/27	5	NM_000059.4	ENSP00000369497.3
BRCA2	ENST00000530893.7	c.8623_8656delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT	p.Ser2875fs	frameshift_variant	23/27	1		ENSP00000499438.2
BRCA2	ENST00000614259.2	n.*1050_*1083delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT		non_coding_transcript_exon_variant	22/26	2		ENSP00000506251.1
BRCA2	ENST00000614259.2	n.*1050_*1083delTCTCTGTTAACAGAAGGAAAGAGATACAGAATTT		3_prime_UTR_variant	22/26	2		ENSP00000506251.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Color Diagnostics, LLC DBA Color Health

Feb 10, 2022

This variant deletes 34 nucleotides in exon 23 of the BRCA2 gene, creating a frameshift and premature translation stop signal. This variant is expected to result in an absent or non-functional protein product. This variant has been reported in individuals affected with early onset and triple-negative breast cancer (PMID: 27616075, Color internal data). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of BRCA2 function is a known mechanism of disease (clinicalgenome.org). Based on the available evidence, this variant is classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555288450; hg19: chr13-32953923;