rs1555449461
Variant summary
Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP5
The NM_001009944.3(PKD1):c.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG(p.Ala3225_Glu3233del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_001009944.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant polycystic kidney diseaseInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- polycystic kidney disease 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- autosomal recessive polycystic kidney diseaseInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- Caroli diseaseInheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 3 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001009944.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PKD1 | MANE Select | c.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG | p.Ala3225_Glu3233del | disruptive_inframe_deletion | Exon 28 of 46 | NP_001009944.3 | P98161-1 | ||
| PKD1 | c.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG | p.Ala3225_Glu3233del | disruptive_inframe_deletion | Exon 28 of 46 | NP_000287.4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PKD1 | TSL:1 MANE Select | c.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG | p.Ala3225_Glu3233del | disruptive_inframe_deletion | Exon 28 of 46 | ENSP00000262304.4 | P98161-1 | ||
| PKD1 | TSL:1 | c.9674_9700delCCAACGGGGGCCTGGTGGAGAAGGAGG | p.Ala3225_Glu3233del | disruptive_inframe_deletion | Exon 28 of 46 | ENSP00000399501.1 | P98161-3 | ||
| PKD1 | TSL:1 | n.1411_1437delCCAACGGGGGCCTGGTGGAGAAGGAGG | non_coding_transcript_exon | Exon 6 of 8 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at