rs1555781547

Variant names:

• chr19-38494362-G-GGAGCTGGTGTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCC
• rs1555781547
• NM_000540.3:c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_000540.3(RYR1):​c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG​(p.Ser2099_Val2117dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000274 in 1,459,160 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000027 (0 hom.)
• Consequence: RYR1 NM_000540.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.19
• Publications: 0 publications found

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

RYR1 Gene-Disease associations (from GenCC):

• malignant hyperthermia, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
• congenital multicore myopathy with external ophthalmoplegia

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• RYR1-related myopathy

  Inheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
• central core myopathy

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• King-Denborough syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• malignant hyperthermia of anesthesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive centronuclear myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• benign Samaritan congenital myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• congenital myopathy with myasthenic-like onset

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• lethal multiple pterygium syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 14 uncertain in NM_000540.3
• PM4: Nonframeshift variant in NON repetitive region in NM_000540.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000540.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RYR1	NM_000540.3	MANE Select	c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG	p.Ser2099_Val2117dup	conservative_inframe_insertion	Exon 39 of 106	NP_000531.2
	RYR1	NM_001042723.2		c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG	p.Ser2099_Val2117dup	conservative_inframe_insertion	Exon 39 of 105	NP_001036188.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RYR1	ENST00000359596.8	TSL:5 MANE Select	c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG	p.Ser2099_Val2117dup	conservative_inframe_insertion	Exon 39 of 106	ENSP00000352608.2
	RYR1	ENST00000355481.8	TSL:1	c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG	p.Ser2099_Val2117dup	conservative_inframe_insertion	Exon 39 of 105	ENSP00000347667.3
	RYR1	ENST00000594335.6	TSL:1	n.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG		non_coding_transcript_exon	Exon 39 of 103	ENSP00000470927.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1459160 Hom.: 0 Cov.: 32 AF XY: 0.00000138 AC XY: 1 AN XY: 725900

African (AFR) AF: 0.00 AC: 0 AN: 33404

American (AMR) AF: 0.00 AC: 0 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86168

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52784

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4158

European-Non Finnish (NFE) AF: 0.00000360 AC: 4 AN: 1111898

Other (OTH) AF: 0.00 AC: 0 AN: 60200

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	RYR1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555781547; hg19: chr19-38985002;