rs1555781547

Positions:

• chr19-38494362-G-GGAGCTGGTGTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_000540.3(RYR1):​c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG​(p.Ser2099_Val2117dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000274 in 1,459,160 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000027 (0 hom.)
• Consequence: RYR1 NM_000540.3 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.19

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000540.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RYR1	NM_000540.3	c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG	p.Ser2099_Val2117dup	conservative_inframe_insertion	39/106	ENST00000359596.8	NP_000531.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RYR1	ENST00000359596.8	c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG	p.Ser2099_Val2117dup	conservative_inframe_insertion	39/106	5	NM_000540.3	ENSP00000352608.2
RYR1	ENST00000355481.8	c.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG	p.Ser2099_Val2117dup	conservative_inframe_insertion	39/105	1		ENSP00000347667.3
RYR1	ENST00000599547.6	n.6295_6351dupTCCCACATGGTGGTGCGCTGGGCCCAAGAGGACTTCGTGCAGAGCCCCGAGCTGGTG		non_coding_transcript_exon_variant	39/80	2		ENSP00000471601.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000274 AC: 4 AN: 1459160 Hom.: 0 Cov.: 32 AF XY: 0.00000138 AC XY: 1 AN XY: 725900

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000360

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

RYR1-related disorder Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 09, 2017

This sequence change inserts 57 nucleotides in exon 39 of the RYR1 mRNA (c.6295_6351dup). This leads to the duplication of 19 amino acid residues in the RYR1 protein (p.Ser2099_Val2117dup) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals a with a RYR1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the inserted amino acids is currently unknown. In summary, this is a novel in-frame duplication with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555781547; hg19: chr19-38985002;