rs1555884869

Variant names:

• chr21-34792391-A-AACGGGCCTCCCTGCGCTTGCG
• rs1555884869
• NM_001754.5:c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001754.5(RUNX1):​c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT​(p.Ser389_Pro395dup) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: RUNX1 NM_001754.5 conservative_inframe_insertion
• Clinical Significance: Uncertain significance reviewed by expert panel U:4
• Conservation: PhyloP100: 5.51
• Publications: 0 publications found

Genes affected

RUNX1 (HGNC:10471): (RUNX family transcription factor 1) Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

RUNX1 Gene-Disease associations (from GenCC):

• hereditary thrombocytopenia and hematologic cancer predisposition syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, G2P
• acute myeloid leukemia

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001754.5.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001754.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX1	NM_001754.5	MANE Select	c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT	p.Ser389_Pro395dup	conservative_inframe_insertion	Exon 9 of 9	NP_001745.2
	RUNX1	NM_001001890.3		c.1085_1105dupCGCAAGCGCAGGGAGGCCCGT	p.Ser362_Pro368dup	conservative_inframe_insertion	Exon 6 of 6	NP_001001890.1	Q01196-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX1	ENST00000675419.1	MANE Select	c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT	p.Ser389_Pro395dup	conservative_inframe_insertion	Exon 9 of 9	ENSP00000501943.1	Q01196-8
	RUNX1	ENST00000300305.7	TSL:1	c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT	p.Ser389_Pro395dup	conservative_inframe_insertion	Exon 8 of 8	ENSP00000300305.3	Q01196-8
	RUNX1	ENST00000344691.8	TSL:1	c.1085_1105dupCGCAAGCGCAGGGAGGCCCGT	p.Ser362_Pro368dup	conservative_inframe_insertion	Exon 6 of 6	ENSP00000340690.4	Q01196-1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000212 AC: 3 AN: 1413792 Hom.: 0 Cov.: 35 AF XY: 0.00000143 AC XY: 1 AN XY: 698852

African (AFR) AF: 0.00 AC: 0 AN: 32578

American (AMR) AF: 0.00 AC: 0 AN: 37012

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25260

East Asian (EAS) AF: 0.00 AC: 0 AN: 37348

South Asian (SAS) AF: 0.00 AC: 0 AN: 80550

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49582

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5704

European-Non Finnish (NFE) AF: 0.00000276 AC: 3 AN: 1087186

Other (OTH) AF: 0.00 AC: 0 AN: 58572

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary thrombocytopenia and hematologic cancer predisposition syndrome (1)
-	1	-	Hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1 (1)
-	1	-	Inborn genetic diseases (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555884869; hg19: chr21-36164688;