rs1555884869

Positions:

• chr21-34792391-A-AACGGGCCTCCCTGCGCTTGCG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001754.5(RUNX1):​c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT​(p.Ser389_Pro395dup) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: RUNX1 NM_001754.5 conservative_inframe_insertion
• Clinical Significance: Uncertain significance reviewed by expert panel U:3
• Conservation: PhyloP100: 5.51

Genes affected

RUNX1 (HGNC:10471): (RUNX family transcription factor 1) Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

RUNX1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001754.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RUNX1	NM_001754.5	c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT	p.Ser389_Pro395dup	conservative_inframe_insertion	9/9	ENST00000675419.1	NP_001745.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RUNX1	ENST00000675419.1	c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT	p.Ser389_Pro395dup	conservative_inframe_insertion	9/9		NM_001754.5	ENSP00000501943.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000212 AC: 3 AN: 1413792 Hom.: 0 Cov.: 35 AF XY: 0.00000143 AC XY: 1 AN XY: 698852

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000276

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: reviewed by expert panel

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

GeneDx

Jul 06, 2023

Not observed at significant frequency in large population cohorts (gnomAD); In-frame duplication of 7 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -

Hereditary thrombocytopenia and hematologic cancer predisposition syndrome Uncertain:1

Uncertain significance, reviewed by expert panel

curation

ClinGen Myeloid Malignancy Variant Curation Expert Panel

Aug 01, 2024

NM_001754.5(RUNX1):c.1166_1186dup (p.Pro395_Phe396insSerGlnAlaGlnGlyGlyPro) is an in-frame duplication variant which is predicted to cause a change in the length of the protein by duplicating 7 amino acids (p.S389_P395dup) in a nonrepeat region but not the runt homology domain (PM4 is not met). The splice site predictor SpliceAI indicated that the variant has no impact on splicing. This variant is absent from gnomAD v2 and v3 (PM2_supporting) and has not been reported in the literature. In summary, this variant meets the criteria to be classified as a variant of uncertain significance for autosomal dominant hereditary thrombocytopenia and hematologic cancer predisposition syndrome based on the ACMG/AMP criteria applied, as specified by the ClinGen Myeloid Malignancy VCEP: PM2_supporting. -

Hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 27, 2022

This variant is not present in population databases (gnomAD no frequency). This variant, c.1166_1186dup, results in the insertion of 7 amino acid(s) of the RUNX1 protein (p.Ser389_Pro395dup), but otherwise preserves the integrity of the reading frame. This variant has not been reported in the literature in individuals affected with RUNX1-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 409806). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555884869; hg19: chr21-36164688;