rs1555884869

Variant names:

• chr21-34792391-A-AACGGGCCTCCCTGCGCTTGCG
• rs1555884869
• NM_001754.5:c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001754.5(RUNX1):​c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT​(p.Ser389_Pro395dup) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: RUNX1 NM_001754.5 conservative_inframe_insertion
• Clinical Significance: Uncertain significance reviewed by expert panel U:3
• Conservation: PhyloP100: 5.51
• Publications: 0 publications found

Genes affected

RUNX1 (HGNC:10471): (RUNX family transcription factor 1) Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

RUNX1 Gene-Disease associations (from GenCC):

• hereditary thrombocytopenia and hematologic cancer predisposition syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae)
• acute myeloid leukemia

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001754.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RUNX1	NM_001754.5	c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT	p.Ser389_Pro395dup	conservative_inframe_insertion	Exon 9 of 9	ENST00000675419.1	NP_001745.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RUNX1	ENST00000675419.1	c.1166_1186dupCGCAAGCGCAGGGAGGCCCGT	p.Ser389_Pro395dup	conservative_inframe_insertion	Exon 9 of 9		NM_001754.5	ENSP00000501943.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000212 AC: 3 AN: 1413792 Hom.: 0 Cov.: 35 AF XY: 0.00000143 AC XY: 1 AN XY: 698852

African (AFR) AF: 0.00 AC: 0 AN: 32578

American (AMR) AF: 0.00 AC: 0 AN: 37012

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25260

East Asian (EAS) AF: 0.00 AC: 0 AN: 37348

South Asian (SAS) AF: 0.00 AC: 0 AN: 80550

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49582

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5704

European-Non Finnish (NFE) AF: 0.00000276 AC: 3 AN: 1087186

Other (OTH) AF: 0.00 AC: 0 AN: 58572

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: reviewed by expert panel

Submissions by phenotype

not provided Uncertain:1

Jul 06, 2023

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Not observed at significant frequency in large population cohorts (gnomAD); In-frame duplication of 7 amino acids in a non-repeat region; Has not been previously published as pathogenic or benign to our knowledge -

Hereditary thrombocytopenia and hematologic cancer predisposition syndrome Uncertain:1

Aug 01, 2024

ClinGen Myeloid Malignancy Variant Curation Expert Panel

Significance: Uncertain significance

Review Status: reviewed by expert panel

Collection Method: curation

NM_001754.5(RUNX1):c.1166_1186dup (p.Pro395_Phe396insSerGlnAlaGlnGlyGlyPro) is an in-frame duplication variant which is predicted to cause a change in the length of the protein by duplicating 7 amino acids (p.S389_P395dup) in a nonrepeat region but not the runt homology domain (PM4 is not met). The splice site predictor SpliceAI indicated that the variant has no impact on splicing. This variant is absent from gnomAD v2 and v3 (PM2_supporting) and has not been reported in the literature. In summary, this variant meets the criteria to be classified as a variant of uncertain significance for autosomal dominant hereditary thrombocytopenia and hematologic cancer predisposition syndrome based on the ACMG/AMP criteria applied, as specified by the ClinGen Myeloid Malignancy VCEP: PM2_supporting. -

Hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1 Uncertain:1

May 27, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 409806). This variant has not been reported in the literature in individuals affected with RUNX1-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.1166_1186dup, results in the insertion of 7 amino acid(s) of the RUNX1 protein (p.Ser389_Pro395dup), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555884869; hg19: chr21-36164688;