rs1556875089
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_004006.3(DMD):c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT(p.Arg435fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R435R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_004006.3 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- dilated cardiomyopathy 3BInheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
- Duchenne and Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- Duchenne muscular dystrophyInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- progressive muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- symptomatic form of muscular dystrophy of Duchenne and Becker in female carriersInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004006.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | MANE Select | c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT | p.Arg435fs | frameshift splice_donor splice_region intron | Exon 11 of 79 | NP_003997.2 | P11532-1 | ||
| DMD | c.1292_1319+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT | p.Arg431fs | frameshift splice_donor splice_region intron | Exon 11 of 79 | NP_004000.1 | P11532 | |||
| DMD | c.1280_1307+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT | p.Arg427fs | frameshift splice_donor splice_region intron | Exon 11 of 79 | NP_000100.3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| DMD | TSL:1 MANE Select | c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT | p.Arg435fs | frameshift splice_donor splice_region intron | Exon 11 of 79 | ENSP00000354923.3 | P11532-1 | ||
| DMD | TSL:1 | c.1280_1307+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT | p.Arg427fs | frameshift splice_donor splice_region intron | Exon 11 of 18 | ENSP00000288447.4 | Q4G0X0 | ||
| DMD | TSL:1 | c.247-70313_247-70276delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT | intron | N/A | ENSP00000395904.1 | Q14174 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at