rs193922563
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_000518.5(HBB):c.93-22_95delTGGTCTATTTTCCCACCCTTAGGCT(p.Leu32del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. R31R) has been classified as Pathogenic.
Frequency
Genomes: not found (cov: 32)
Exomes 𝑓: 0.0000055 ( 0 hom. )
Failed GnomAD Quality Control
Consequence
HBB
NM_000518.5 splice_acceptor, conservative_inframe_deletion, splice_region, intron
NM_000518.5 splice_acceptor, conservative_inframe_deletion, splice_region, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 7.47
Genes affected
HBB (HGNC:4827): (hemoglobin subunit beta) The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.5 fraction of the gene. Cryptic splice site detected, with MaxEntScore 5.6, offset of -18, new splice context is: gactcttgggtttctgatAGgca. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
PP5
Variant 11-5226796-CAGCCTAAGGGTGGGAAAATAGACCA-C is Pathogenic according to our data. Variant chr11-5226796-CAGCCTAAGGGTGGGAAAATAGACCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 15442.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr11-5226796-CAGCCTAAGGGTGGGAAAATAGACCA-C is described in Lovd as [Pathogenic]. Variant chr11-5226796-CAGCCTAAGGGTGGGAAAATAGACCA-C is described in Lovd as [Pathogenic].
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| HBB | NM_000518.5 | c.93-22_95delTGGTCTATTTTCCCACCCTTAGGCT | p.Leu32del | splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | 2/3 | ENST00000335295.4 | NP_000509.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| HBB | ENST00000335295.4 | c.93-22_95delTGGTCTATTTTCCCACCCTTAGGCT | p.Leu32del | splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | 2/3 | 1 | NM_000518.5 | ENSP00000333994.3 |
Frequencies
GnomAD3 genomes
GnomAD3 genomes
Cov.:
32
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000547 AC: 8AN: 1461706Hom.: 0 AF XY: 0.00000825 AC XY: 6AN XY: 727190
GnomAD4 exome
Data not reliable, filtered out with message: AS_VQSR
AF:
AC:
8
AN:
1461706
Hom.:
AF XY:
AC XY:
6
AN XY:
727190
Gnomad4 AFR exome
AF:
Gnomad4 AMR exome
AF:
Gnomad4 ASJ exome
AF:
Gnomad4 EAS exome
AF:
Gnomad4 SAS exome
AF:
Gnomad4 FIN exome
AF:
Gnomad4 NFE exome
AF:
Gnomad4 OTH exome
AF:
GnomAD4 genome
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:18
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
not provided Pathogenic:6
| Pathogenic, criteria provided, single submitter | clinical testing | GeneDx | Jul 08, 2022 | Canonical splice site variant in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 6308558, 35467101, 6190800) - |
| Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Jan 04, 2024 | This variant results in the deletion of part of exon 2 (c.93-22_95del) of the HBB gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in HBB are known to be pathogenic (PMID: 23637309). This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with beta-thalassemia (PMID: 6190800, 20437613, 23637309, 26076396). This variant is also known as IVS-1, 25bp del. ClinVar contains an entry for this variant (Variation ID: 15442). Studies have shown that this variant alters HBB gene expression (PMID: 6190800). For these reasons, this variant has been classified as Pathogenic. - |
| Pathogenic, criteria provided, single submitter | clinical testing | Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital | Jul 31, 2024 | - - |
| Pathogenic, criteria provided, single submitter | clinical testing | Revvity Omics, Revvity | Jul 08, 2020 | - - |
| Pathogenic, criteria provided, single submitter | clinical testing | ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories | Jan 13, 2023 | The HBB c.93-22_95del variant (also known as IVS-1 25 bp del, HbVarID: 974, rs193922563) is reported in the literature in several individuals with beta-thalassemia (Adekile 2015, Miri-Moghaddam 2016, Orkin 1983, HbVar database). This variant was found in three siblings of one family, all of whom also carried an additional pathogenic variant (Adekile 2015). This variant is also reported in ClinVar (Variation ID: 15442). This variant is absent from the Genome Aggregation Database, indicating it is not a common polymorphism. This variant deletes 25 nucleotides and abolishes the canonical splice acceptor site of intron 1, which is likely to disrupt gene function. Indeed, RNA analyses of cells expressing this variant show a lack of properly spliced transcripts (Orkin 1983). Based on available information, this variant is considered to be pathogenic. References: Link to HbVar database: https://globin.bx.psu.edu/hbvar/menu.html Adekile AD et al. Clinical and Molecular Characteristics of Non-Transfusion-Dependent Thalassemia in Kuwait. Hemoglobin. 2015;39(5):320-6. PMID: 26076396. Miri-Moghaddam E et al. Molecular Characterization of ß-Thalassemia Intermedia in Southeast Iran. Hemoglobin. 2016 Jun;40(3):173-8. PMID: 27117567. Orkin SH et al. Inactivation of an acceptor RNA splice site by a short deletion in beta-thalassemia. J Biol Chem. 1983 Jun 25;258(12):7249-51. PMID: 6190800. - |
| Pathogenic, criteria provided, single submitter | clinical testing | Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital | Dec 17, 2022 | - - |
Beta-thalassemia HBB/LCRB Pathogenic:5
| Pathogenic, criteria provided, single submitter | clinical testing | Genetics and Molecular Pathology, SA Pathology | Jul 03, 2020 | PVS1, PS3, PM2, PP4, PP5 - |
| Pathogenic, criteria provided, single submitter | clinical testing | 3billion | Feb 23, 2023 | The variant is not observed in the gnomAD v2.1.1 dataset. This variant was predicted to alter splicing and result in a loss or disruption of normal protein function. Multiple pathogenic loss-of-function variants are reported downstream of the variant. The variant has been reported at least twice as pathogenic with clinical assertions and evidence for the classification (ClinVar ID: VCV000015442). Therefore, this variant is classified as Pathogenic according to the recommendation of ACMG/AMP guideline. - |
| Pathogenic, no assertion criteria provided | clinical testing | Zotz-Klimas Genetics Lab, MVZ Zotz Klimas | Nov 24, 2023 | - - |
| Pathogenic, criteria provided, single submitter | clinical testing | Juno Genomics, Hangzhou Juno Genomics, Inc | - | PM2_Supporting+PVS1+PS4 - |
| Pathogenic, criteria provided, single submitter | clinical testing | Neuberg Centre For Genomic Medicine, NCGM | - | The invariant splice acceptor variant c.93-22_95del in HBB gene has been observed in compound heterozygous state in multiple individuals with beta-thalassemia Adekile et. al., 2015; Thein SL, 2013. This variant is also known as IVS-1, 25bp del. Studies have shown that this variant alters HBB gene expression Orkin et. al., 1983. The c.93-22_95del variant is novel not in any individuals in gnomAD Exomes and 1000 Genomes. This variant has been reported to the ClinVar database as Pathogenic by multiple submitters. This variant results in the deletion of part of exon 2 c.93-22_95del of the HBB gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function Baralle et. al., 2005, and loss-of-function variants in HBB are known to be pathogenic Thein SL, 2013. For these reasons, this variant has been classified as Pathogenic. - |
beta Thalassemia Pathogenic:3
| Pathogenic, no assertion criteria provided | clinical testing | Natera, Inc. | Sep 16, 2020 | - - |
| Pathogenic, criteria provided, single submitter | clinical testing | Women's Health and Genetics/Laboratory Corporation of America, LabCorp | Sep 27, 2021 | Variant summary: HBB c.93-22_95del25 is located in a canonical splice-site and is predicted to affect mRNA splicing resulting in a significantly altered protein due to either exon skipping, shortening, or inclusion of intronic material. Several computational tools predict a significant impact on normal splicing: five predict the variant abolishes a 3 prime acceptor site, which has been confirmed by a functional study (Orkin_1983). This variant was absent in 251322 control chromosomes (gnomAD). c.93-22_95del25 has been reported in the literature in individuals affected with Beta Thalassemia (Orkin_1983, Adekile_2015). These data indicate that the variant is likely to be associated with disease. Three clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. - |
| Pathogenic, criteria provided, single submitter | clinical testing | Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine | Nov 03, 2022 | The c.93-22_95del25 variant in HBB has been reported in individuals affected with Beta Thalassemia (Orkin 1983 PMID: 6190800, Adekile 2015 PMID: 26076396, Al Gazali 2010 PMID: 20437613). It has also been reported in ClinVar (Variation ID 15415) and was absent from large population studies. This deletion encompasses the canonical splice site (+/- 1,2) and is predicted to cause altered splicing leading to an abnormal or absent protein. Loss of function of the HBB gene is an established disease mechanism in autosomal recessive beta thalassemia. In summary, this variant meets criteria to be classified as pathogenic for autosomal recessive beta thalassemia. ACMG/AMP Criteria applied: PM2_Supporting, PVS1, PM3. - |
not specified Pathogenic:1
| Pathogenic, flagged submission | clinical testing | Al Jalila Children’s Genomics Center, Al Jalila Childrens Speciality Hospital | Jul 21, 2020 | - - |
Beta zero thalassemia Pathogenic:1
| Pathogenic, no assertion criteria provided | literature only | OMIM | Jul 25, 1983 | - - |
Inborn genetic diseases Pathogenic:1
| Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Jun 16, 2017 | The c.93-22_95del25 pathogenic mutation, located at the boundary of intron 1 and coding exon 2 of the HBB gene, results from a deletion of 25 nucleotides between nucleotide positions 93-22 and 95. This alteration is predicted to disrupt the canonical splice acceptor site sequence and result in the deletion of three nucleotides from coding exon 2. This alteration was reported in an Asian Indian individual with beta-thalassemia and was shown to abolish the normal splicing when expressed in HeLa cells (Orkin SH et al. J. Biol. Chem., 1983 Jun;258:7249-51). In addition to the clinical data presented in the literature, alterations that disrupt the canonical splice donor site are typically deleterious in nature, this alteration is interpreted as a disease-causing mutation. - |
Malaria, susceptibility to Pathogenic:1
| Pathogenic, criteria provided, single submitter | clinical testing | Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center | Mar 26, 2024 | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at