rs387906342

Variant names:

• chr9-133443514-GCCAGCTGTGGCGCTGGAAACCTGCAA-G
• rs387906342
• NM_139027.6:c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_139027.6(ADAMTS13):​c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC​(p.Ala793ProfsTer43) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000701 in 1,426,146 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
• Consequence: ADAMTS13 NM_139027.6 frameshift
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 2.02
• Publications: 3 publications found

Genes affected

ADAMTS13 (HGNC:1366): (ADAM metallopeptidase with thrombospondin type 1 motif 13) This gene encodes a member of a family of proteins containing several distinct regions, including a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. The enzyme encoded by this gene specifically cleaves von Willebrand Factor (vWF). Defects in this gene are associated with thrombotic thrombocytopenic purpura. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

ADAMTS13 Gene-Disease associations (from GenCC):

• congenital thrombotic thrombocytopenic purpura

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Genomics England PanelApp

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 9-133443514-GCCAGCTGTGGCGCTGGAAACCTGCAA-G is Pathogenic according to our data. Variant chr9-133443514-GCCAGCTGTGGCGCTGGAAACCTGCAA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 5806.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_139027.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ADAMTS13	NM_139027.6	MANE Select	c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC	p.Ala793ProfsTer43	frameshift	Exon 19 of 29	NP_620596.2	Q76LX8-2
	ADAMTS13	NM_139025.5		c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC	p.Ala793ProfsTer43	frameshift	Exon 19 of 29	NP_620594.1	Q76LX8-1
	ADAMTS13	NM_139026.6		c.2283_2308delAGCTGTGGCGCTGGAAACCTGCAACC	p.Ala762ProfsTer43	frameshift	Exon 19 of 29	NP_620595.1	Q76LX8-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ADAMTS13	ENST00000355699.7	TSL:1 MANE Select	c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC	p.Ala793ProfsTer43	frameshift	Exon 19 of 29	ENSP00000347927.2	Q76LX8-2
	ADAMTS13	ENST00000371929.7	TSL:1	c.2376_2401delAGCTGTGGCGCTGGAAACCTGCAACC	p.Ala793ProfsTer43	frameshift	Exon 19 of 29	ENSP00000360997.3	Q76LX8-1
	ADAMTS13	ENST00000356589.6	TSL:1	c.2283_2308delAGCTGTGGCGCTGGAAACCTGCAACC	p.Ala762ProfsTer43	frameshift	Exon 19 of 29	ENSP00000348997.2	Q76LX8-3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 7.01e-7 AC: 1 AN: 1426146 Hom.: 0 AF XY: 0.00000141 AC XY: 1 AN XY: 707268

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 32744

American (AMR) AF: 0.00 AC: 0 AN: 42344

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25494

East Asian (EAS) AF: 0.00 AC: 0 AN: 37978

South Asian (SAS) AF: 0.00 AC: 0 AN: 82122

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 41372

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4774

European-Non Finnish (NFE) AF: 9.09e-7 AC: 1 AN: 1100226

Other (OTH) AF: 0.00 AC: 0 AN: 59092

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Upshaw-Schulman syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs387906342;

hg19: chr9-136308635;