rs521

chr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-Gchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATATATATATchr7-126532764-GATATATATATATATATATATATATATATATATATATATATAT-GATATATATATATATATATATATATATATATATATATATATATATATATATATATATAT

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000845.3(GRM8):c.2430+146_2430+187del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000721 in 110,982 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.000072 (0 hom., cov: 0)
• Consequence: GRM8 NM_000845.3 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.98

Genes affected

GRM8 (HGNC:4600): (glutamate metabotropic receptor 8) L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

LOC101928357 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
GRM8	NM_000845.3	c.2430+146_2430+187del		intron_variant		ENST00000339582.7
LOC101928357	XR_927937.3	n.215-1977_215-1936del		intron_variant, non_coding_transcript_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
GRM8	ENST00000339582.7	c.2430+146_2430+187del		intron_variant		5	NM_000845.3	P1

Frequencies

GnomAD3 genomes AF: 0.0000721 AC: 8 AN: 110982 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.000199

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000104

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000184

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000721 AC: 8 AN: 110982 Hom.: 0 Cov.: 0 AF XY: 0.0000383 AC XY: 2 AN XY: 52268

Gnomad4 AFR AF: 0.000199

Gnomad4 AMR AF: 0.000104

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000184

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs521; hg19: chr7-126172818;