rs587776824

Variant names:

• chr2-176093052-GGGGCGGGCGGCGGCGGCGGCA-G
• rs587776824
• NM_000523.4:c.164_184delGGCGGGCGGCGGCGGCGGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000523.4(HOXD13):​c.164_184delGGCGGGCGGCGGCGGCGGCAG​(p.Gly55_Ala61del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: HOXD13 NM_000523.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 3.39
• Publications: 1 publications found

Genes affected

HOXD13 (HGNC:5136): (homeobox D13) This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. Mutations in this particular gene cause synpolydactyly. [provided by RefSeq, Jul 2008]

HOXD13 Gene-Disease associations (from GenCC):

• brachydactyly-syndactyly syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Laboratory for Molecular Medicine
• synpolydactyly type 1

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• brachydactyly type E

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• syndactyly type 5

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000523.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000523.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HOXD13	NM_000523.4	MANE Select	c.164_184delGGCGGGCGGCGGCGGCGGCAG	p.Gly55_Ala61del	disruptive_inframe_deletion	Exon 1 of 2	NP_000514.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HOXD13	ENST00000392539.4	TSL:1 MANE Select	c.164_184delGGCGGGCGGCGGCGGCGGCAG	p.Gly55_Ala61del	disruptive_inframe_deletion	Exon 1 of 2	ENSP00000376322.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

VATER association Uncertain:1

Dec 15, 2008

OMIM

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: literature only

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587776824; hg19: chr2-176957780;