rs776641008

Variant names:

• chr3-183020101-ACATCATTCTACAGATGTCATGTGATTACCTTTT-A
• rs776641008
• NM_020166.5:c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_020166.5(MCCC1):​c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG​(p.Glu658fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MCCC1 NM_020166.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 0.488

Genes affected

MCCC1 (HGNC:6936): (methylcrotonyl-CoA carboxylase subunit 1) This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-183020101-ACATCATTCTACAGATGTCATGTGATTACCTTTT-A is Pathogenic according to our data. Variant chr3-183020101-ACATCATTCTACAGATGTCATGTGATTACCTTTT-A is described in ClinVar as [Likely_pathogenic]. Clinvar id is 498130.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MCCC1	NM_020166.5	c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG	p.Glu658fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 17 of 19	ENST00000265594.9	NP_064551.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MCCC1	ENST00000265594.9	c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG	p.Glu658fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 17 of 19	1	NM_020166.5	ENSP00000265594.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD3 exomes AF: 0.00000400 AC: 1 AN: 250084 Hom.: 0 AF XY: 0.00000740 AC XY: 1 AN XY: 135182

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000290

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

Oct 27, 2016

Eurofins Ntd Llc (ga)

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

3-methylcrotonyl-CoA carboxylase 1 deficiency Pathogenic:1

Aug 31, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of the last 5 nucleotides of exon 17 and affects a donor splice site in intron 17 of the MCCC1 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in MCCC1 are known to be pathogenic (PMID: 11181649, 15359379, 22642865). This variant is present in population databases (rs776641008, gnomAD 0.003%). This variant has not been reported in the literature in individuals affected with MCCC1-related conditions. ClinVar contains an entry for this variant (Variation ID: 498130). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs776641008; hg19: chr3-182737889;