rs776641008

Variant names:

• chr3-183020101-ACATCATTCTACAGATGTCATGTGATTACCTTTT-A
• rs776641008
• NM_020166.5:c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_020166.5(MCCC1):​c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG​(p.Glu658fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MCCC1 NM_020166.5 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 0.488
• Publications: 0 publications found

Genes affected

MCCC1 (HGNC:6936): (methylcrotonyl-CoA carboxylase subunit 1) This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]

MCCC1 Gene-Disease associations (from GenCC):

• 3-methylcrotonyl-CoA carboxylase 1 deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• 3-methylcrotonyl-CoA carboxylase deficiency

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 3-183020101-ACATCATTCTACAGATGTCATGTGATTACCTTTT-A is Pathogenic according to our data. Variant chr3-183020101-ACATCATTCTACAGATGTCATGTGATTACCTTTT-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 498130.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020166.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MCCC1	NM_020166.5	MANE Select	c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG	p.Glu658fs	frameshift splice_donor splice_region intron	Exon 17 of 19	NP_064551.3
	MCCC1	NM_001363880.1		c.1646_1650+28delAAAAGGTAATCACATGACATCTGTAGAATGATG	p.Glu549fs	frameshift splice_donor splice_region intron	Exon 16 of 18	NP_001350809.1	E9PHF7
	MCCC1	NM_001293273.2		c.1622_1626+28delAAAAGGTAATCACATGACATCTGTAGAATGATG	p.Glu541fs	frameshift splice_donor splice_region intron	Exon 15 of 17	NP_001280202.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MCCC1	ENST00000265594.9	TSL:1 MANE Select	c.1973_1977+28delAAAAGGTAATCACATGACATCTGTAGAATGATG	p.Glu658fs	frameshift splice_donor splice_region intron	Exon 17 of 19	ENSP00000265594.4	Q96RQ3
	MCCC1	ENST00000492597.5	TSL:1	c.1646_1650+28delAAAAGGTAATCACATGACATCTGTAGAATGATG	p.Glu549fs	frameshift splice_donor splice_region intron	Exon 16 of 18	ENSP00000419898.1	E9PHF7
	MCCC1	ENST00000497830.5	TSL:1	n.*1570_*1574+28delAAAAGGTAATCACATGACATCTGTAGAATGATG		splice_region non_coding_transcript_exon	Exon 15 of 17	ENSP00000420088.1	F2Z3E2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00000400 AC: 1 AN: 250084 AF XY: 0.00000740

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000290

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	3-methylcrotonyl-CoA carboxylase 1 deficiency (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.49
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs776641008; hg19: chr3-182737889;