rs863224965
Variant summary
Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PM4PP3PP5_Very_Strong
The NM_000070.3(CAPN3):c.643_663delTCCTACGAAGCTCTGAAAGGT(p.Ser215_Gly221del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000118 in 1,613,852 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★★).
Frequency
Consequence
NM_000070.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 11 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CAPN3 | NM_000070.3 | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 24 | ENST00000397163.8 | NP_000061.1 | |
CAPN3 | NM_024344.2 | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 23 | NP_077320.1 | ||
CAPN3 | NM_173087.2 | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 21 | NP_775110.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CAPN3 | ENST00000397163.8 | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 24 | 1 | NM_000070.3 | ENSP00000380349.3 | ||
ENSG00000258461 | ENST00000495723.1 | n.*439_*459delTCCTACGAAGCTCTGAAAGGT | non_coding_transcript_exon_variant | Exon 9 of 26 | 2 | ENSP00000492063.1 | ||||
ENSG00000258461 | ENST00000495723.1 | n.*439_*459delTCCTACGAAGCTCTGAAAGGT | 3_prime_UTR_variant | Exon 9 of 26 | 2 | ENSP00000492063.1 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152156Hom.: 0 Cov.: 32
GnomAD3 exomes AF: 0.0000159 AC: 4AN: 251476Hom.: 0 AF XY: 0.0000147 AC XY: 2AN XY: 135906
GnomAD4 exome AF: 0.0000123 AC: 18AN: 1461696Hom.: 0 AF XY: 0.0000138 AC XY: 10AN XY: 727160
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152156Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74332
ClinVar
Submissions by phenotype
not provided Pathogenic:5
- -
- -
Previously identified in the heterozygous state, without a second variant, in multiple individuals with variable features including muscle weakness/atrophy, hyperCKemia, myalgia, back pain, and reduced calpain protein on western blot analysis and muscle biopsy; however, comprehensive testing, including deletion/duplication analysis, was not completed for all patients and inheritance from an unaffected parent was noted (PMID: 28881388, 18337726, 27259757); In silico analysis supports a deleterious effect on protein structure/function; In-frame deletion of 7 amino acids in a non-repeat region; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 19556129, 18055493, 10330340, 9150160, 18337726, 27259757, 28881388, 22443334) -
- -
PS3, PS4_moderate, PM2, PM4, PP1 -
Autosomal recessive limb-girdle muscular dystrophy type 2A Pathogenic:3Other:1
A single heterozygous in-frame c.643_663del21 pathogenic variant in CAPN3 results in a dominantly inherited form of calpainopathy [Vissing et al 2016]. Of note, this variant has been identified in compound heterozygosity with other pathogenic variants in CAPN3, including c.2362_2363delinsTCATCT, c.550delA, p.Ala45Thr, and p.Asp419Gly [Richard et al 1997, Groen et al 2007, Saenz & Lopez de Munain 2017]. Pathogenic variant most likely the result of a founder effect followed by genetic isolation in populations in Northern European countries including UK, Norway, Sweden, Denmark [Vissing et al 2016] -
This variant, c.643_663del, results in the deletion of 7 amino acid(s) of the CAPN3 protein (p.Ser215_Gly221del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs772579407, gnomAD 0.004%). This variant has been observed in individuals with autosomal dominant and autosomal recessive limb-girdle muscular dystrophy (PMID: 18337726, 27259757, 28881388; internal data). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 217159). For these reasons, this variant has been classified as Pathogenic. -
- -
- -
Muscular dystrophy, limb-girdle, autosomal dominant 4 Pathogenic:3
- -
- -
Based on the classification scheme VCGS_Germline_v1.3.4, this variant is classified as Pathogenic. Following criteria are met: 0103 - Dominant negative and loss of function are known mechanisms of disease in this gene and are associated with limb-girdle muscular dystrophy. Loss of function is a known disease mechanism associated with recessive limb-girdle muscular dystrophy whereas the dominant negative mechanism is suggested for the dominant form of disease associated with milder phenotypes and later age of onset (ClinVar, PMID: 27259757). (I) 0108 - This gene is associated with both recessive and dominant disease. It is predominantly reported as a recessive condition with the dominant condition reported with only a few missense variants and one in-frame deletion (PMID: 27259757, 28881388, 31066050). (I) 0213 - In-frame insertion/deletion in a non-repetitive region that has high conservation. (SP) 0251 - This variant is heterozygous. (I) 0302 - Variant is present in gnomAD (v2) <0.001 for a dominant condition (4 heterozygotes, 0 homozygotes). (SP) 0600 - Variant is located in the annotated peptidase_C2 domain (DECIPHER). (I) 0801 - This variant has strong previous evidence of pathogenicity in unrelated individuals. The variant has been previously reported in multiple patients with autosomal dominant limb-girdle muscular dystrophy (MIM#618129) (ClinVar, PMID: 27259757, 28881388). (SP) 1001 - This variant has strong functional evidence supporting abnormal protein function. Functional studies have shown that this variant causes a reduction in CAPN3 protein levels in muscle biopsies from affected individuals (PMID: 27259757). (SP) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -
Autosomal recessive limb-girdle muscular dystrophy Pathogenic:1
The NM_000070.3: c.643_663del p.(Ser215_Gly221del) variant in CAPN3 is predicted to cause a change in the length of the protein due to an in-frame deletion of 7 amino acids in a non-repeat region (PM4). This variant has been detected in at least five individuals reported to have autosomal recessive LGMD (PMID: 18055493, 9150160, 22443334; ClinVar SCV000331951.4 internal data communication). In at least one case, the variant was identified in trans with a pathogenic variant (c.2362_2363delinsTCATCT p.(Arg788fsTer14), 1.0 pt, PMID: 9150160), and in at least three patients, the variant was homozygous (1.0 pt, PMID: 22443334, ClinVar SCV000331951.4 internal data communication) (PM3_Strong). At least one of these patients displayed progressive limb girdle muscle weakness and reduced calpain-3 protein expression, which is specific for CAPN3-related LGMD (PP4_Moderate; PMID: 22443334). The variant was also reported to co-segregate with autosomal recessive disease in one affected family member (PP1; PMID: 9150160). The filtering allele frequency of the c.643_663del variant in CAPN3 is 0.000080464 in the European (non-Finnish) population in gnomAD v2.1.1 (the upper threshold of the 95% CI of 4/113756 exome chromosomes), which is less than the ClinGen LGMD VCEP threshold (≤0.0001) (PM2_Supporting). In summary, this variant meets the criteria to be classified as Pathogenic for autosomal recessive limb girdle muscular dystrophy based on the ACMG/AMP criteria applied, as specified by the ClinGen LGMD VCEP (LGMD VCEP specifications version 1.0.0; 01/07/2025): PM4, PM3_Strong, PP4_Moderate, PP1, PM2_Supporting. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at