rs863224965
Variant summary
Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1PM4PP3PP5_Very_Strong
The NM_000070.3(CAPN3):c.643_663delTCCTACGAAGCTCTGAAAGGT(p.Ser215_Gly221del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000118 in 1,613,852 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★).
Frequency
Consequence
NM_000070.3 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- muscular dystrophy, limb-girdle, autosomal dominantInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- autosomal recessive limb-girdle muscular dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- autosomal recessive limb-girdle muscular dystrophy type 2AInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae)
- limb-girdle muscular dystrophyInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- muscular dystrophy, limb-girdle, autosomal dominant 4Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 13 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000070.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CAPN3 | MANE Select | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 24 | NP_000061.1 | P20807-1 | ||
| CAPN3 | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 23 | NP_077320.1 | P20807-3 | |||
| CAPN3 | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 21 | NP_775110.1 | P20807-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CAPN3 | TSL:1 MANE Select | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 24 | ENSP00000380349.3 | P20807-1 | ||
| CAPN3 | TSL:1 | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 23 | ENSP00000350181.3 | P20807-3 | ||
| CAPN3 | TSL:1 | c.643_663delTCCTACGAAGCTCTGAAAGGT | p.Ser215_Gly221del | conservative_inframe_deletion | Exon 5 of 21 | ENSP00000183936.4 | P20807-2 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152156Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000159 AC: 4AN: 251476 AF XY: 0.0000147 show subpopulations
GnomAD4 exome AF: 0.0000123 AC: 18AN: 1461696Hom.: 0 AF XY: 0.0000138 AC XY: 10AN XY: 727160 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152156Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74332 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at