11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT

Variant names:

• chr11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT
• rs1555163780
• NM_001370259.2:c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001370259.2(MEN1):​c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG​(p.Glu469ArgfsTer98) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 34)
• Consequence: MEN1 NM_001370259.2 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.251

Genes affected

MEN1 (HGNC:7010): (menin 1) This gene encodes menin, a tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. Menin is a scaffold protein that functions in histone modification and epigenetic gene regulation. It is thought to regulate several pathways and processes by altering chromatin structure through the modification of histones. [provided by RefSeq, May 2019]

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 42 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT is Pathogenic according to our data. Variant chr11-64804762-C-CCTCGGCCTCGGCCGCCTCGGCCT is described in ClinVar as [Pathogenic]. Clinvar id is 403843.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MEN1	NM_001370259.2	c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG	p.Glu469ArgfsTer98	frameshift_variant	Exon 10 of 10	ENST00000450708.7	NP_001357188.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MEN1	ENST00000450708.7	c.1382_1404dupAGGCCGAGGCGGCCGAGGCCGAG	p.Glu469ArgfsTer98	frameshift_variant	Exon 10 of 10	5	NM_001370259.2	ENSP00000394933.3

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome Cov.: 43

GnomAD4 genome Cov.: 34

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Multiple endocrine neoplasia, type 1 Pathogenic:1

Jun 11, 2016

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change inserts 23 nucleotides in exon 10 of the MEN1 mRNA (c.1382_1404dup), causing a frameshift at codon 469. This creates a premature translational stop signal in the last exon of the MEN1 mRNA (p.Glu469Argfs*98). While this is not anticipated to result in nonsense mediated decay, it is expected to result in a truncated MEN1 protein, eliminating 142 C-terminal amino acid residues. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a MEN1-related disease. In summary, this is a novel variant that truncates an important functional domain in MEN1. For this reason, it has been classified as Pathogenic. This frameshift truncates the functionally conserved nuclear localization signal of the MEN1 protein. Experimental studies have shown that disruption of this region abrogates the ability of MEN1 to bind DNA, regulate target gene expression, and inhibit cell proliferation (PMID: 15331604, 16449969). In addition, a different frameshift variant (p.Arg516Glyfs*43) with a premature termination codon downstream of this frameshift has been reported to be a common cause of multiple endocrine neoplasia type 1 (PMID: 17879353) -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555163780; hg19: chr11-64572234;