chr12-4275795-ATACCAAAGCACTGATGGGCTATTCTGATTCACTCCAGTTTCCTCATCTTTGTTCTTTATTCTTATCACGCATTCTGGTCCCCTCCCCCTCCCACAAAAAAAAATTAATTTTTTTTGTTTCGATAGATTACGCTTTTTTATTCTTTTTCTCTTTTGCTGATGCTATGCTCTCCACCCCCGCCCCCCAACCCTTTCCCACTCCCATTATAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCCATGAAT-A

Variant names:

• chr12-4275795-ATACCAAAGCACTGATGGGCTATTCTGATTCACTCCAGTTTCCTCATCTTTGTTCTTTATTCTTATCACGCATTCTGGTCCCCTCCCCCTCCCACAAAAAAAAATTAATTTTTTTTGTTTCGATAGATTACGCTTTTTTATTCTTTTTCTCTTTTGCTGATGCTATGCTCTCCACCCCCGCCCCCCAACCCTTTCCCACTCCCATTATAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCCATGAAT-A
• NM_001759.4:c.196-205_250del

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The ENST00000261254.8(CCND2):​c.196-209_246del​(p.Val66_Tyr83del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. V66V) has been classified as Uncertain significance.

• Frequency: Genomes: not found (cov: 29)
• Consequence: CCND2 ENST00000261254.8 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.06
• Publications: 0 publications found

Genes affected

CCND2 (HGNC:1583): (cyclin D2) The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK4 or CDK6 and functions as a regulatory subunit of the complex, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. Knockout studies of the homologous gene in mouse suggest the essential roles of this gene in ovarian granulosa and germ cell proliferation. High level expression of this gene was observed in ovarian and testicular tumors. Mutations in this gene are associated with megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (MPPH3). [provided by RefSeq, Sep 2014]

ENSG00000285901 (HGNC:):

CCND2-AS1 (HGNC:49398): (CCND2 antisense RNA 1)

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.24827586 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000261254.8. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CCND2	NM_001759.4	MANE Select	c.196-205_250del	p.Val66fs	frameshift splice_acceptor splice_region intron	Exon 2 of 5	NP_001750.1	P30279-1
	CCND2-AS1	NR_125790.1		n.126+4_126+263del		splice_region intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CCND2	ENST00000261254.8	TSL:1 MANE Select	c.196-209_246del	p.Val66_Tyr83del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 2 of 5	ENSP00000261254.3	P30279-1
	ENSG00000285901	ENST00000674624.1		n.196-209_246del		splice_acceptor splice_region intron non_coding_transcript_exon	Exon 2 of 10	ENSP00000501898.1	A0A6Q8PFP0
	CCND2	ENST00000675880.1		c.196-209_246del	p.Val66_Tyr83del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 2 of 6	ENSP00000502508.1	A0A6Q8PGZ3

Frequencies

GnomAD3 genomes Cov.: 29

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 29

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Inborn genetic diseases (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr12-4384961;