19-38565561-CGAGGGCGCTGGAGACGCCGCG-CGAGGGCGCTGGAGACGCCGCGGAGGGCGCTGGAGACGCCGCG

Variant names:

• chr19-38565561-C-CGAGGGCGCTGGAGACGCCGCG
• rs763413580
• NM_000540.3:c.13244_13264dupCCGCGGAGGGCGCTGGAGACG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_000540.3(RYR1):​c.13244_13264dupCCGCGGAGGGCGCTGGAGACG​(p.Ala4415_Asp4421dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000937 in 1,483,368 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.000079 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000095 (0 hom.)
• Consequence: RYR1 NM_000540.3 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 2.35

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000540.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RYR1	NM_000540.3	c.13244_13264dupCCGCGGAGGGCGCTGGAGACG	p.Ala4415_Asp4421dup	disruptive_inframe_insertion	Exon 91 of 106	ENST00000359596.8	NP_000531.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RYR1	ENST00000359596.8	c.13244_13264dupCCGCGGAGGGCGCTGGAGACG	p.Ala4415_Asp4421dup	disruptive_inframe_insertion	Exon 91 of 106	5	NM_000540.3	ENSP00000352608.2

Frequencies

GnomAD3 genomes AF: 0.0000790 AC: 12 AN: 151962 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000725

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000655

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000118

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000117 AC: 1 AN: 85708 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 48658

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000562

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000954 AC: 127 AN: 1331406 Hom.: 0 Cov.: 31 AF XY: 0.000105 AC XY: 69 AN XY: 656378

Gnomad4 AFR exome AF: 0.000111

Gnomad4 AMR exome AF: 0.0000678

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000337

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.000108

Gnomad4 OTH exome AF: 0.000126

GnomAD4 genome AF: 0.0000790 AC: 12 AN: 151962 Hom.: 0 Cov.: 32 AF XY: 0.0000539 AC XY: 4 AN XY: 74212

Gnomad4 AFR AF: 0.0000725

Gnomad4 AMR AF: 0.0000655

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000118

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

RYR1-related disorder Uncertain:2

Aug 13, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.13244_13264dup, results in the insertion of 7 amino acid(s) to the RYR1 protein (p.Ala4415_Asp4421dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This variant has been observed in individual(s) with congenital myopathy (Invitae). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Sep 12, 2024

PreventionGenetics, part of Exact Sciences

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The RYR1 c.13244_13264dup21 variant is predicted to result in an in-frame duplication (p.Ala4415_Asp4421dup). To our knowledge, this variant has not been reported in the literature. This variant is reported in 0.0056% of alleles in individuals of Latino descent in gnomAD. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -

not specified Uncertain:1

Jun 12, 2024

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: RYR1 c.13244_13264dup21 (p.Ala4415_Asp4421dup) results in an in-frame duplication that is predicted to duplicate 7 amino acids into the encoded protein. The variant allele was found at a frequency of 1.2e-05 in 85708 control chromosomes (gnomAD). The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.13244_13264dup21 in individuals affected with Myopathy, RYR1-Associated and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 287765). Based on the evidence outlined above, the variant was classified as uncertain significance. -

not provided Uncertain:1

May 19, 2016

Eurofins Ntd Llc (ga)

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs763413580; hg19: chr19-39056201;