chr21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C

Variant names:

• chr21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C
• rs2040477031
• NM_000383.4:c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PS1_Moderate PP5_Moderate

The NM_000383.4(AIRE):​c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: AIRE NM_000383.4 frameshift, start_lost
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.05
• Publications: 0 publications found

Genes affected

AIRE (HGNC:360): (autoimmune regulator) This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]

AIRE Gene-Disease associations (from GenCC):

• autoimmune polyendocrine syndrome type 1

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, Myriad Women’s Health, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics, Genomics England PanelApp
• familial isolated hypoparathyroidism due to impaired PTH secretion

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 184 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_000383.4 (AIRE) was described as [Pathogenic] in ClinVar
• PP5: Variant 21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C is Pathogenic according to our data. Variant chr21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 954404.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000383.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AIRE	NM_000383.4	MANE Select	c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG	p.Met1fs	frameshift start_lost	Exon 1 of 14	NP_000374.1	O43918-1
	AIRE	NM_000383.4	MANE Select	c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG		5_prime_UTR	Exon 1 of 14	NP_000374.1	O43918-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AIRE	ENST00000291582.6	TSL:1 MANE Select	c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG	p.Met1fs	frameshift start_lost	Exon 1 of 14	ENSP00000291582.5	O43918-1
	AIRE	ENST00000291582.6	TSL:1 MANE Select	c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG		5_prime_UTR	Exon 1 of 14	ENSP00000291582.5	O43918-1
	AIRE	ENST00000966178.1		c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG	p.Met1fs	frameshift start_lost	Exon 1 of 14	ENSP00000636237.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Polyglandular autoimmune syndrome, type 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1
Mutation Taster		=54/146	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2040477031; hg19: chr21-45705868;