rs2040477031

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1PS1_ModeratePM2PP5_Moderate

The NM_000383.4(AIRE):​c.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

AIRE
NM_000383.4 frameshift, start_lost

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 1.05
Variant links:
Genes affected
AIRE (HGNC:360): (autoimmune regulator) This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 14 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 187 pathogenic variants in the truncated region.
PS1
Another start lost variant in NM_000383.4 (AIRE) was described as [Pathogenic] in ClinVar as 3314
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C is Pathogenic according to our data. Variant chr21-44285985-CCCGGGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACG-C is described in ClinVar as [Pathogenic]. Clinvar id is 954404.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
AIRENM_000383.4 linkc.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG p.Met1fs frameshift_variant, start_lost Exon 1 of 14 ENST00000291582.6 NP_000374.1 O43918-1
AIRENM_000383.4 linkc.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG 5_prime_UTR_variant Exon 1 of 14 ENST00000291582.6 NP_000374.1 O43918-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
AIREENST00000291582.6 linkc.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG p.Met1fs frameshift_variant, start_lost Exon 1 of 14 1 NM_000383.4 ENSP00000291582.5 O43918-1
AIREENST00000291582 linkc.-17_27delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG 5_prime_UTR_variant Exon 1 of 14 1 NM_000383.4 ENSP00000291582.5 O43918-1
AIREENST00000527919.5 linkn.145_188delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG non_coding_transcript_exon_variant Exon 1 of 14 2
AIREENST00000530812.5 linkn.153_196delGTCCCCGCGCCCACCCCATGGCGACGGACGCGGCGCTACGCCGG non_coding_transcript_exon_variant Exon 1 of 12 2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Polyglandular autoimmune syndrome, type 1 Pathogenic:1
Sep 22, 2019
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This sequence change affects the initiator methionine of the AIRE mRNA. The next in-frame methionine is located at codon 184. Disruption of the initiator codon has been observed in several individuals affected with autoimmune polyendocrinopathy syndrome (PMID: 28911151, 20407228, 19758376, 28446514). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs2040477031; hg19: chr21-45705868; API