5-132369842-ACCCTCCGCGGACGGTCTTGGGTCGCCTG-A

Position:

• chr5-132369842-ACCCTCCGCGGACGGTCTTGGGTCGCCTG-A

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_003060.4(SLC22A5):​c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000132 in 151,940 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: 𝑓 0.000013 (0 hom., cov: 33)
• Consequence: SLC22A5 NM_003060.4 5_prime_UTR
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.88

Genes affected

SLC22A5 (HGNC:10969): (solute carrier family 22 member 5) Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]

MIR3936HG (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SLC22A5	NM_003060.4	c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC		5_prime_UTR_variant	1/10	ENST00000245407.8	NP_003051.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SLC22A5	ENST00000245407	c.-129_-102delCCTCCGCGGACGGTCTTGGGTCGCCTGC		5_prime_UTR_variant	1/10	1	NM_003060.4	ENSP00000245407.3

Frequencies

GnomAD3 genomes AF: 0.0000132 AC: 2 AN: 151940 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.0000484

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.0000132 AC: 2 AN: 151940 Hom.: 0 Cov.: 33 AF XY: 0.0000135 AC XY: 1 AN XY: 74230

Gnomad4 AFR AF: 0.0000484

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Renal carnitine transport defect Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Counsyl

Feb 13, 2018

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1279199437; hg19: chr5-131705534;