7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCT

Variant names:

• chr7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCT
• NM_001277115.2:c.13320_13350dupCCAAGCAGGAACCATTGTTGAAGCCCGTCTC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Moderate PM2 PP5_Moderate

The NM_001277115.2(DNAH11):​c.13320_13350dupCCAAGCAGGAACCATTGTTGAAGCCCGTCTC​(p.Lys4451ProfsTer7) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: DNAH11 NM_001277115.2 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.590

Genes affected

DNAH11 (HGNC:2942): (dynein axonemal heavy chain 11) This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]

CDCA7L (HGNC:30777): (cell division cycle associated 7 like) Acts upstream of or within positive regulation of cell population proliferation. Located in cytosol; fibrillar center; and nucleoplasm. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0148 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCT is Pathogenic according to our data. Variant chr7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCT is described in ClinVar as [Pathogenic]. Clinvar id is 1944204.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DNAH11	NM_001277115.2	c.13320_13350dupCCAAGCAGGAACCATTGTTGAAGCCCGTCTC	p.Lys4451ProfsTer7	frameshift_variant, stop_gained	Exon 82 of 82	ENST00000409508.8	NP_001264044.1
CDCA7L	NM_018719.5	c.*1270_*1300dupAGACGGGCTTCAACAATGGTTCCTGCTTGGG		3_prime_UTR_variant	Exon 10 of 10	ENST00000406877.8	NP_061189.2
CDCA7L	NM_001127370.3	c.*1270_*1300dupAGACGGGCTTCAACAATGGTTCCTGCTTGGG		3_prime_UTR_variant	Exon 11 of 11		NP_001120842.1
CDCA7L	NM_001127371.3	c.*1270_*1300dupAGACGGGCTTCAACAATGGTTCCTGCTTGGG		3_prime_UTR_variant	Exon 9 of 9		NP_001120843.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DNAH11	ENST00000409508.8	c.13320_13350dupCCAAGCAGGAACCATTGTTGAAGCCCGTCTC	p.Lys4451ProfsTer7	frameshift_variant, stop_gained	Exon 82 of 82	5	NM_001277115.2	ENSP00000475939.1
CDCA7L	ENST00000406877	c.*1270_*1300dupAGACGGGCTTCAACAATGGTTCCTGCTTGGG		3_prime_UTR_variant	Exon 10 of 10	1	NM_018719.5	ENSP00000383986.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary ciliary dyskinesia Pathogenic:1

Sep 21, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Lys4451Profs*7) in the DNAH11 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 66 amino acid(s) of the DNAH11 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with DNAH11-related conditions. This variant disrupts a region of the DNAH11 protein in which other variant(s) (p.Trp4505Serfs*10) have been determined to be pathogenic (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr7-21940639;