chr7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCT
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_ModeratePM2PP5_Moderate
The NM_001277115.2(DNAH11):c.13320_13350dupCCAAGCAGGAACCATTGTTGAAGCCCGTCTC(p.Lys4451fs) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Genomes: not found (cov: 33)
Consequence
DNAH11
NM_001277115.2 frameshift, stop_gained
NM_001277115.2 frameshift, stop_gained
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: -0.590
Genes affected
DNAH11 (HGNC:2942): (dynein axonemal heavy chain 11) This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
CDCA7L (HGNC:30777): (cell division cycle associated 7 like) Acts upstream of or within positive regulation of cell population proliferation. Located in cytosol; fibrillar center; and nucleoplasm. [provided by Alliance of Genome Resources, Apr 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0148 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCT is Pathogenic according to our data. Variant chr7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCT is described in ClinVar as [Pathogenic]. Clinvar id is 1944204.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
DNAH11 | NM_001277115.2 | c.13320_13350dupCCAAGCAGGAACCATTGTTGAAGCCCGTCTC | p.Lys4451fs | frameshift_variant, stop_gained | 82/82 | ENST00000409508.8 | NP_001264044.1 | |
CDCA7L | NM_018719.5 | c.*1270_*1300dupAGACGGGCTTCAACAATGGTTCCTGCTTGGG | 3_prime_UTR_variant | 10/10 | ENST00000406877.8 | NP_061189.2 | ||
CDCA7L | NM_001127370.3 | c.*1270_*1300dupAGACGGGCTTCAACAATGGTTCCTGCTTGGG | 3_prime_UTR_variant | 11/11 | NP_001120842.1 | |||
CDCA7L | NM_001127371.3 | c.*1270_*1300dupAGACGGGCTTCAACAATGGTTCCTGCTTGGG | 3_prime_UTR_variant | 9/9 | NP_001120843.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
DNAH11 | ENST00000409508.8 | c.13320_13350dupCCAAGCAGGAACCATTGTTGAAGCCCGTCTC | p.Lys4451fs | frameshift_variant, stop_gained | 82/82 | 5 | NM_001277115.2 | ENSP00000475939.1 | ||
CDCA7L | ENST00000406877 | c.*1270_*1300dupAGACGGGCTTCAACAATGGTTCCTGCTTGGG | 3_prime_UTR_variant | 10/10 | 1 | NM_018719.5 | ENSP00000383986.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
GnomAD4 exome Cov.: 33
GnomAD4 exome
Cov.:
33
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Primary ciliary dyskinesia Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Sep 21, 2022 | For these reasons, this variant has been classified as Pathogenic. This variant disrupts a region of the DNAH11 protein in which other variant(s) (p.Trp4505Serfs*10) have been determined to be pathogenic (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. This variant has not been reported in the literature in individuals affected with DNAH11-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Lys4451Profs*7) in the DNAH11 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 66 amino acid(s) of the DNAH11 protein. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.