NM_000465.4:c.95_115delGTGCCTGGGCCCACAGTCGCG
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000465.4(BARD1):c.95_115delGTGCCTGGGCCCACAGTCGCG(p.Gly32_Arg38del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000000685 in 1,459,128 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000465.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| BARD1 | NM_000465.4 | c.95_115delGTGCCTGGGCCCACAGTCGCG | p.Gly32_Arg38del | disruptive_inframe_deletion | Exon 1 of 11 | ENST00000260947.9 | NP_000456.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| BARD1 | ENST00000260947.9 | c.95_115delGTGCCTGGGCCCACAGTCGCG | p.Gly32_Arg38del | disruptive_inframe_deletion | Exon 1 of 11 | 1 | NM_000465.4 | ENSP00000260947.4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 6.85e-7 AC: 1AN: 1459128Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 725926 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Hereditary cancer-predisposing syndrome Uncertain:2
The c.95_115del21 variant (also known as p.G32_R38del) is located in coding exon 1 of the BARD1 gene. This variant results from an in-frame GTGCCTGGGCCCACAGTCGCG deletion at nucleotide positions 95 to 115. This results in the in-frame deletion of seven residues at codon 32 to 38. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
This variant is an in-frame seven amino acid deletion in exon 1 of the BARD1 protein. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
not specified Uncertain:1
Variant summary: BARD1 c.95_115del21 (p.Gly32_Arg38del) results in an in-frame deletion that is predicted to remove seven amino acids from the encoded protein. The variant was absent in 239666 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.95_115del21 in individuals affected with Breast Cancer and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 481385). Based on the evidence outlined above, the variant was classified as uncertain significance. -
Familial cancer of breast Uncertain:1
This variant, c.95_115del, results in the deletion of 7 amino acid(s) of the BARD1 protein (p.Gly32_Arg38del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with BARD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 481385). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at