rs1553628381
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000465.4(BARD1):c.95_115delGTGCCTGGGCCCACAGTCGCG(p.Gly32_Arg38del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000000685 in 1,459,128 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_000465.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000465.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BARD1 | MANE Select | c.95_115delGTGCCTGGGCCCACAGTCGCG | p.Gly32_Arg38del | disruptive_inframe_deletion | Exon 1 of 11 | NP_000456.2 | Q99728-1 | ||
| BARD1 | c.95_115delGTGCCTGGGCCCACAGTCGCG | p.Gly32_Arg38del | disruptive_inframe_deletion | Exon 1 of 10 | NP_001269472.1 | Q99728-2 | |||
| BARD1 | c.95_115delGTGCCTGGGCCCACAGTCGCG | p.Gly32_Arg38del | disruptive_inframe_deletion | Exon 1 of 7 | NP_001269474.1 | C9IYG1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BARD1 | TSL:1 MANE Select | c.95_115delGTGCCTGGGCCCACAGTCGCG | p.Gly32_Arg38del | disruptive_inframe_deletion | Exon 1 of 11 | ENSP00000260947.4 | Q99728-1 | ||
| BARD1 | TSL:1 | c.95_115delGTGCCTGGGCCCACAGTCGCG | p.Gly32_Arg38del | disruptive_inframe_deletion | Exon 1 of 10 | ENSP00000480470.1 | Q99728-2 | ||
| BARD1 | TSL:1 | c.95_115delGTGCCTGGGCCCACAGTCGCG | p.Gly32_Arg38del | disruptive_inframe_deletion | Exon 1 of 11 | ENSP00000484976.2 | A0A087X2H0 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 6.85e-7 AC: 1AN: 1459128Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 725926 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at