rs1553628381

Positions:

• chr2-214809454-GCGCGACTGTGGGCCCAGGCAC-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_000465.4(BARD1):​c.95_115delGTGCCTGGGCCCACAGTCGCG​(p.Gly32_Arg38del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000000685 in 1,459,128 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: BARD1 NM_000465.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 4.41

Genes affected

BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

BARD1 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000465.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
BARD1	NM_000465.4	c.95_115delGTGCCTGGGCCCACAGTCGCG	p.Gly32_Arg38del	disruptive_inframe_deletion	1/11	ENST00000260947.9	NP_000456.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
BARD1	ENST00000260947.9	c.95_115delGTGCCTGGGCCCACAGTCGCG	p.Gly32_Arg38del	disruptive_inframe_deletion	1/11	1	NM_000465.4	ENSP00000260947.4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 6.85e-7 AC: 1 AN: 1459128 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 725926

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.00e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	Jan 30, 2023	This variant is an in-frame seven amino acid deletion in exon 1 of the BARD1 protein. To our knowledge, functional studies have not been reported for this variant. This variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -
Uncertain significance, criteria provided, single submitter	clinical testing	Ambry Genetics	Sep 09, 2022	The c.95_115del21 variant (also known as p.G32_R38del) is located in coding exon 1 of the BARD1 gene. This variant results from an in-frame GTGCCTGGGCCCACAGTCGCG deletion at nucleotide positions 95 to 115. This results in the in-frame deletion of seven residues at codon 32 to 38. This amino acid region is well conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

May 21, 2024

Variant summary: BARD1 c.95_115del21 (p.Gly32_Arg38del) results in an in-frame deletion that is predicted to remove seven amino acids from the encoded protein. The variant was absent in 239666 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. To our knowledge, no occurrence of c.95_115del21 in individuals affected with Breast Cancer and no experimental evidence demonstrating its impact on protein function have been reported. ClinVar contains an entry for this variant (Variation ID: 481385). Based on the evidence outlined above, the variant was classified as uncertain significance. -

Familial cancer of breast Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 30, 2023

This variant, c.95_115del, results in the deletion of 7 amino acid(s) of the BARD1 protein (p.Gly32_Arg38del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with BARD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 481385). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553628381; hg19: chr2-215674178;