rs1553628381

Variant names:

• chr2-214809454-GCGCGACTGTGGGCCCAGGCAC-G
• rs1553628381
• NM_000465.4:c.95_115delGTGCCTGGGCCCACAGTCGCG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000465.4(BARD1):​c.95_115delGTGCCTGGGCCCACAGTCGCG​(p.Gly32_Arg38del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000000685 in 1,459,128 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: BARD1 NM_000465.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:4
• Conservation: PhyloP100: 4.41
• Publications: 1 publications found

Genes affected

BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

SNHG31 (HGNC:54196): (small nucleolar RNA host gene 31)

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000465.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000465.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BARD1	NM_000465.4	MANE Select	c.95_115delGTGCCTGGGCCCACAGTCGCG	p.Gly32_Arg38del	disruptive_inframe_deletion	Exon 1 of 11	NP_000456.2	Q99728-1
	BARD1	NM_001282543.2		c.95_115delGTGCCTGGGCCCACAGTCGCG	p.Gly32_Arg38del	disruptive_inframe_deletion	Exon 1 of 10	NP_001269472.1	Q99728-2
	BARD1	NM_001282545.2		c.95_115delGTGCCTGGGCCCACAGTCGCG	p.Gly32_Arg38del	disruptive_inframe_deletion	Exon 1 of 7	NP_001269474.1	C9IYG1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BARD1	ENST00000260947.9	TSL:1 MANE Select	c.95_115delGTGCCTGGGCCCACAGTCGCG	p.Gly32_Arg38del	disruptive_inframe_deletion	Exon 1 of 11	ENSP00000260947.4	Q99728-1
	BARD1	ENST00000617164.5	TSL:1	c.95_115delGTGCCTGGGCCCACAGTCGCG	p.Gly32_Arg38del	disruptive_inframe_deletion	Exon 1 of 10	ENSP00000480470.1	Q99728-2
	BARD1	ENST00000613706.5	TSL:1	c.95_115delGTGCCTGGGCCCACAGTCGCG	p.Gly32_Arg38del	disruptive_inframe_deletion	Exon 1 of 11	ENSP00000484976.2	A0A087X2H0

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 6.85e-7 AC: 1 AN: 1459128 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 725926

African (AFR) AF: 0.00 AC: 0 AN: 33462

American (AMR) AF: 0.00 AC: 0 AN: 44634

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26040

East Asian (EAS) AF: 0.00 AC: 0 AN: 39658

South Asian (SAS) AF: 0.00 AC: 0 AN: 86100

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 51628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 9.00e-7 AC: 1 AN: 1111566

Other (OTH) AF: 0.00 AC: 0 AN: 60276

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	Hereditary cancer-predisposing syndrome (2)
-	1	-	Familial cancer of breast (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553628381; hg19: chr2-215674178;