NM_000756.4:c.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG

Variant names:

• chr8-66177297-C-CCTGCGGCTGCTGGGGCTGCTCGGA
• NM_000756.4:c.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_000756.4(CRH):​c.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG​(p.Gln60_Ala61insSerGluGlnProGlnGlnProGln) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CRH NM_000756.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.31
• Publications: 0 publications found

Genes affected

CRH (HGNC:2355): (corticotropin releasing hormone) This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015]

LINC00967 (HGNC:48725): (long intergenic non-protein coding RNA 967)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000756.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CRH	NM_000756.4	MANE Select	c.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG	p.Gln60_Ala61insSerGluGlnProGlnGlnProGln	conservative_inframe_insertion	Exon 2 of 2	NP_000747.1	A0A0S2Z478

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CRH	ENST00000276571.5	TSL:1 MANE Select	c.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG	p.Gln60_Ala61insSerGluGlnProGlnGlnProGln	conservative_inframe_insertion	Exon 2 of 2	ENSP00000276571.3	P06850
	CRH	ENST00000948625.1		c.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG	p.Gln60_Ala61insSerGluGlnProGlnGlnProGln	conservative_inframe_insertion	Exon 2 of 2	ENSP00000618684.1
	LINC00967	ENST00000729586.1		n.44_67dupTGCTGGGGCTGCTCGGACTGCGGC		non_coding_transcript_exon	Exon 1 of 4

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr8-67089532;