chr8-66177297-C-CCTGCGGCTGCTGGGGCTGCTCGGA

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000756.4(CRH):​c.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG​(p.Gln60_Ala61insSerGluGlnProGlnGlnProGln) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

CRH
NM_000756.4 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.31
Variant links:
Genes affected
CRH (HGNC:2355): (corticotropin releasing hormone) This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CRHNM_000756.4 linkc.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG p.Gln60_Ala61insSerGluGlnProGlnGlnProGln conservative_inframe_insertion Exon 2 of 2 ENST00000276571.5 NP_000747.1 P06850A0A0S2Z478

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CRHENST00000276571.5 linkc.157_180dupTCCGAGCAGCCCCAGCAGCCGCAG p.Gln60_Ala61insSerGluGlnProGlnGlnProGln conservative_inframe_insertion Exon 2 of 2 1 NM_000756.4 ENSP00000276571.3 P06850

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
May 17, 2018
Ambry Genetics
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.157_180dup24 variant (also known as p.S53_Q60dup), located in coding exon 1 of the CRH gene, results from an in-frame duplication of 24 nucleotides at nucleotide positions 157 to 180. This results in the duplication of 8 extra residues (SEQPQQPQ) between codons 53 and 60. These amino acid positions are poorly conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr8-67089532; API