NM_001277115.2:c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001277115.2(DNAH11):c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA(p.Thr4475_Leu4485del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001277115.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
DNAH11 | NM_001277115.2 | c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA | p.Thr4475_Leu4485del | disruptive_inframe_deletion | Exon 82 of 82 | ENST00000409508.8 | NP_001264044.1 | |
CDCA7L | NM_018719.5 | c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC | 3_prime_UTR_variant | Exon 10 of 10 | ENST00000406877.8 | NP_061189.2 | ||
CDCA7L | NM_001127370.3 | c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC | 3_prime_UTR_variant | Exon 11 of 11 | NP_001120842.1 | |||
CDCA7L | NM_001127371.3 | c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC | 3_prime_UTR_variant | Exon 9 of 9 | NP_001120843.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
DNAH11 | ENST00000409508.8 | c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA | p.Thr4475_Leu4485del | disruptive_inframe_deletion | Exon 82 of 82 | 5 | NM_001277115.2 | ENSP00000475939.1 | ||
CDCA7L | ENST00000406877 | c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC | 3_prime_UTR_variant | Exon 10 of 10 | 1 | NM_018719.5 | ENSP00000383986.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Primary ciliary dyskinesia Uncertain:1
This variant, c.13424_13456del, results in the deletion of 11 amino acid(s) of the DNAH11 protein (p.Thr4475_Leu4485del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with clinical features of DNAH11-related conditions (Invitae). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at