rs1554294443
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_001277115.2(DNAH11):c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA(p.Thr4475_Leu4485del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 33)
Consequence
DNAH11
NM_001277115.2 disruptive_inframe_deletion
NM_001277115.2 disruptive_inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 5.95
Genes affected
DNAH11 (HGNC:2942): (dynein axonemal heavy chain 11) This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
CDCA7L (HGNC:30777): (cell division cycle associated 7 like) Acts upstream of or within positive regulation of cell population proliferation. Located in cytosol; fibrillar center; and nucleoplasm. [provided by Alliance of Genome Resources, Apr 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 4 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_001277115.2.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
DNAH11 | NM_001277115.2 | c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA | p.Thr4475_Leu4485del | disruptive_inframe_deletion | 82/82 | ENST00000409508.8 | NP_001264044.1 | |
CDCA7L | NM_018719.5 | c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC | 3_prime_UTR_variant | 10/10 | ENST00000406877.8 | NP_061189.2 | ||
CDCA7L | NM_001127370.3 | c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC | 3_prime_UTR_variant | 11/11 | NP_001120842.1 | |||
CDCA7L | NM_001127371.3 | c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC | 3_prime_UTR_variant | 9/9 | NP_001120843.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
DNAH11 | ENST00000409508.8 | c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA | p.Thr4475_Leu4485del | disruptive_inframe_deletion | 82/82 | 5 | NM_001277115.2 | ENSP00000475939.1 | ||
CDCA7L | ENST00000406877 | c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC | 3_prime_UTR_variant | 10/10 | 1 | NM_018719.5 | ENSP00000383986.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Primary ciliary dyskinesia Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Aug 31, 2021 | This variant, c.13424_13456del, results in the deletion of 11 amino acid(s) of the DNAH11 protein (p.Thr4475_Leu4485del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with clinical features of DNAH11-related conditions (Invitae). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at