rs1554294443

Variant names:

• chr7-21901124-AGACCTACGAGTGCCCTGTGTATAGAACCAAACT-A
• rs1554294443
• NM_001277115.2:c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_001277115.2(DNAH11):​c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA​(p.Thr4475_Leu4485del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: DNAH11 NM_001277115.2 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 5.95

Genes affected

DNAH11 (HGNC:2942): (dynein axonemal heavy chain 11) This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]

CDCA7L (HGNC:30777): (cell division cycle associated 7 like) Acts upstream of or within positive regulation of cell population proliferation. Located in cytosol; fibrillar center; and nucleoplasm. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_001277115.2.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DNAH11	NM_001277115.2	c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA	p.Thr4475_Leu4485del	disruptive_inframe_deletion	Exon 82 of 82	ENST00000409508.8	NP_001264044.1
CDCA7L	NM_018719.5	c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC		3_prime_UTR_variant	Exon 10 of 10	ENST00000406877.8	NP_061189.2
CDCA7L	NM_001127370.3	c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC		3_prime_UTR_variant	Exon 11 of 11		NP_001120842.1
CDCA7L	NM_001127371.3	c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC		3_prime_UTR_variant	Exon 9 of 9		NP_001120843.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DNAH11	ENST00000409508.8	c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA	p.Thr4475_Leu4485del	disruptive_inframe_deletion	Exon 82 of 82	5	NM_001277115.2	ENSP00000475939.1
CDCA7L	ENST00000406877	c.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC		3_prime_UTR_variant	Exon 10 of 10	1	NM_018719.5	ENSP00000383986.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Primary ciliary dyskinesia Uncertain:1

Aug 31, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.13424_13456del, results in the deletion of 11 amino acid(s) of the DNAH11 protein (p.Thr4475_Leu4485del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with clinical features of DNAH11-related conditions (Invitae). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554294443; hg19: chr7-21940742;