rs1554294443

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4

The NM_001277115.2(DNAH11):​c.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA​(p.Thr4475_Leu4485del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 33)

Consequence

DNAH11
NM_001277115.2 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 5.95
Variant links:
Genes affected
DNAH11 (HGNC:2942): (dynein axonemal heavy chain 11) This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
CDCA7L (HGNC:30777): (cell division cycle associated 7 like) Acts upstream of or within positive regulation of cell population proliferation. Located in cytosol; fibrillar center; and nucleoplasm. [provided by Alliance of Genome Resources, Apr 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_001277115.2.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
DNAH11NM_001277115.2 linkc.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA p.Thr4475_Leu4485del disruptive_inframe_deletion Exon 82 of 82 ENST00000409508.8 NP_001264044.1 Q96DT5Q96NT7H9NAJ8H9NAJ7
CDCA7LNM_018719.5 linkc.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC 3_prime_UTR_variant Exon 10 of 10 ENST00000406877.8 NP_061189.2 Q96GN5-1A0A024RA51A8K8X5
CDCA7LNM_001127370.3 linkc.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC 3_prime_UTR_variant Exon 11 of 11 NP_001120842.1 Q96GN5-4
CDCA7LNM_001127371.3 linkc.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC 3_prime_UTR_variant Exon 9 of 9 NP_001120843.1 Q96GN5-5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
DNAH11ENST00000409508.8 linkc.13424_13456delCCTACGAGTGCCCTGTGTATAGAACCAAACTGA p.Thr4475_Leu4485del disruptive_inframe_deletion Exon 82 of 82 5 NM_001277115.2 ENSP00000475939.1 Q96DT5
CDCA7LENST00000406877 linkc.*1165_*1197delAGTTTGGTTCTATACACAGGGCACTCGTAGGTC 3_prime_UTR_variant Exon 10 of 10 1 NM_018719.5 ENSP00000383986.3 Q96GN5-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Primary ciliary dyskinesia Uncertain:1
Aug 31, 2021
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant, c.13424_13456del, results in the deletion of 11 amino acid(s) of the DNAH11 protein (p.Thr4475_Leu4485del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with clinical features of DNAH11-related conditions (Invitae). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554294443; hg19: chr7-21940742; API