NM_018026.4:c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC

Variant names:

• chr11-66070581-C-CGCCGCCGCAGCAGCAGCAGCAGCA
• rs756417166
• NM_018026.4:c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC

Variant summary

Our verdict is Benign. Variant got -12 ACMG points: 0P and 12B. BP6_Very_Strong BS2

The NM_018026.4(PACS1):​c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC​(p.Gln37_Gln44dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00025 in 151,776 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00025 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00060 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PACS1 NM_018026.4 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 0.0330

Genes affected

PACS1 (HGNC:30032): (phosphofurin acidic cluster sorting protein 1) This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -12 ACMG points.

• BP6: Variant 11-66070581-C-CGCCGCCGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chr11-66070581-C-CGCCGCCGCAGCAGCAGCAGCAGCA is described in ClinVar as [Likely_benign]. Clinvar id is 1235931.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAd4 at 38 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PACS1	NM_018026.4	c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC	p.Gln37_Gln44dup	disruptive_inframe_insertion	Exon 1 of 24	ENST00000320580.9	NP_060496.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PACS1	ENST00000320580.9	c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC	p.Gln37_Gln44dup	disruptive_inframe_insertion	Exon 1 of 24	1	NM_018026.4	ENSP00000316454.4
PACS1	ENST00000527224.1	n.234_257dupAGCAGCAGCAGCCGCCGCAGCAGC		non_coding_transcript_exon_variant	Exon 1 of 7	2

Frequencies

GnomAD3 genomes AF: 0.000251 AC: 38 AN: 151668 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000725

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000657

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000207

Gnomad FIN AF: 0.0000953

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000472

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000232 AC: 22 AN: 94962 Hom.: 0 AF XY: 0.000333 AC XY: 18 AN XY: 54004

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000514

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000598

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000281

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000602 AC: 808 AN: 1341878 Hom.: 0 Cov.: 31 AF XY: 0.000583 AC XY: 386 AN XY: 662332

Gnomad4 AFR exome AF: 0.0000367

Gnomad4 AMR exome AF: 0.0000644

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000864

Gnomad4 FIN exome AF: 0.0000882

Gnomad4 NFE exome AF: 0.000681

Gnomad4 OTH exome AF: 0.000251

GnomAD4 genome AF: 0.000250 AC: 38 AN: 151776 Hom.: 0 Cov.: 32 AF XY: 0.000216 AC XY: 16 AN XY: 74180

Gnomad4 AFR AF: 0.0000723

Gnomad4 AMR AF: 0.0000656

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000207

Gnomad4 FIN AF: 0.0000953

Gnomad4 NFE AF: 0.000472

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

May 12, 2020

Genetic Services Laboratory, University of Chicago

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Inborn genetic diseases Benign:1

Nov 09, 2021

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

PACS1-related disorder Benign:1

Sep 15, 2023

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

not provided Benign:1

Apr 30, 2021

GeneDx

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Schuurs-Hoeijmakers syndrome Benign:1

Mar 02, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs756417166; hg19: chr11-65838052;