NM_018026.4:c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC

Variant names:

• chr11-66070581-C-CGCCGCCGCAGCAGCAGCAGCAGCA
• rs756417166
• NM_018026.4:c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3 BP6_Very_Strong BS2

The NM_018026.4(PACS1):​c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC​(p.Gln37_Gln44dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00025 in 151,776 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. P45P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.00025 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00060 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PACS1 NM_018026.4 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 0.0330
• Publications: 0 publications found

Genes affected

PACS1 (HGNC:30032): (phosphofurin acidic cluster sorting protein 1) This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]

PACS1 Gene-Disease associations (from GenCC):

• Schuurs-Hoeijmakers syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Orphanet, ClinGen

ENSG00000255038 (HGNC:):

ACMG classification

Our verdict: Benign. The variant received -13 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_018026.4
• BP6: Variant 11-66070581-C-CGCCGCCGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chr11-66070581-C-CGCCGCCGCAGCAGCAGCAGCAGCA is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 1235931.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAd4 at 38 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_018026.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PACS1	NM_018026.4	MANE Select	c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC	p.Gln37_Gln44dup	disruptive_inframe_insertion	Exon 1 of 24	NP_060496.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PACS1	ENST00000320580.9	TSL:1 MANE Select	c.110_133dupAGCAGCAGCAGCCGCCGCAGCAGC	p.Gln37_Gln44dup	disruptive_inframe_insertion	Exon 1 of 24	ENSP00000316454.4	Q6VY07-1
	PACS1	ENST00000527224.1	TSL:2	n.234_257dupAGCAGCAGCAGCCGCCGCAGCAGC		non_coding_transcript_exon	Exon 1 of 7
	ENSG00000255038	ENST00000830157.1		n.29+425_29+448dupTGCTGCTGCTGCTGCTGCGGCGGC		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.000251 AC: 38 AN: 151668 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000725

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000657

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000207

Gnomad FIN AF: 0.0000953

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000472

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000232 AC: 22 AN: 94962 AF XY: 0.000333

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000514

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000281

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000602 AC: 808 AN: 1341878 Hom.: 0 Cov.: 31 AF XY: 0.000583 AC XY: 386 AN XY: 662332

African (AFR) AF: 0.0000367 AC: 1 AN: 27240

American (AMR) AF: 0.0000644 AC: 2 AN: 31052

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23558

East Asian (EAS) AF: 0.00 AC: 0 AN: 29758

South Asian (SAS) AF: 0.000864 AC: 65 AN: 75218

European-Finnish (FIN) AF: 0.0000882 AC: 3 AN: 34000

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4184

European-Non Finnish (NFE) AF: 0.000681 AC: 723 AN: 1060994

Other (OTH) AF: 0.000251 AC: 14 AN: 55874

GnomAD4 genome AF: 0.000250 AC: 38 AN: 151776 Hom.: 0 Cov.: 32 AF XY: 0.000216 AC XY: 16 AN XY: 74180

African (AFR) AF: 0.0000723 AC: 3 AN: 41478

American (AMR) AF: 0.0000656 AC: 1 AN: 15250

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5124

South Asian (SAS) AF: 0.000207 AC: 1 AN: 4826

European-Finnish (FIN) AF: 0.0000953 AC: 1 AN: 10492

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.000472 AC: 32 AN: 67834

Other (OTH) AF: 0.00 AC: 0 AN: 2108

Alfa AF: 0.0000777 Hom.: 0

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Inborn genetic diseases (1)
-	-	1	not provided (1)
-	-	1	not specified (1)
-	-	1	PACS1-related disorder (1)
-	-	1	Schuurs-Hoeijmakers syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.033
Mutation Taster		=88/12	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs756417166; hg19: chr11-65838052;