chr17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The NM_183065.4(TMEM107):c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_183065.4 3_prime_UTR
Scores
Clinical Significance
Conservation
Publications
- leukoencephalopathy with calcifications and cystsInheritance: AR Classification: STRONG, MODERATE Submitted by: Laboratory for Molecular Medicine, PanelApp Australia, G2P, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_183065.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TMEM107 | MANE Select | c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT | 3_prime_UTR | Exon 5 of 5 | NP_898888.1 | Q6UX40-1 | |||
| SNORD118 | MANE Select | n.-7_22dupTGTCTGTATCGTCAGGTGGGATAATCCTT | non_coding_transcript_exon | Exon 1 of 1 | |||||
| TMEM107 | c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT | 3_prime_UTR | Exon 5 of 5 | NP_115730.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TMEM107 | TSL:1 MANE Select | c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT | 3_prime_UTR | Exon 5 of 5 | ENSP00000402732.2 | Q6UX40-1 | |||
| TMEM107 | TSL:1 | c.*657_*685dupTGTCTGTATCGTCAGGTGGGATAATCCTT | 3_prime_UTR | Exon 2 of 2 | ENSP00000404753.2 | B2RDT5 | |||
| SNORD118 | TSL:6 MANE Select | n.-7_22dupTGTCTGTATCGTCAGGTGGGATAATCCTT | non_coding_transcript_exon | Exon 1 of 1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 0
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.