rs1555525654

Variant names:

• chr17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA
• rs1555525654
• ENST00000363593.2:n.-7_22dupTGTCTGTATCGTCAGGTGGGATAATCCTT

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The ENST00000363593.2(SNORD118):​n.-7_22dupTGTCTGTATCGTCAGGTGGGATAATCCTT variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: SNORD118 ENST00000363593.2 non_coding_transcript_exon
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.60
• Publications: 0 publications found

Genes affected

SNORD118 (HGNC:32952): (small nucleolar RNA, C/D box 118)

TMEM107 (HGNC:28128): (transmembrane protein 107) This gene encodes a transmembrane protein and component of the primary cilia transition zone. The encoded protein regulates ciliogenesis and ciliary protein composition. Human fibroblasts expressing a mutant allele of this gene exhibit reduced numbers of cilia, altered cilia length, and impaired sonic hedgehog signaling. In human patients, different mutations in this gene cause different ciliopathies, including Meckel-Gruber syndrome and orofaciodigital syndrome. [provided by RefSeq, May 2017]

TMEM107 Gene-Disease associations (from GenCC):

• Meckel syndrome 13

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• ciliopathy

  Inheritance: AR Classification: MODERATE Submitted by: Ambry Genetics
• Meckel syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• orofaciodigital syndrome 16

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA is Pathogenic according to our data. Variant chr17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA is described in ClinVar as Pathogenic. ClinVar VariationId is 265785.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000363593.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SNORD118	NR_033294.2	MANE Select	n.-7_22dupTGTCTGTATCGTCAGGTGGGATAATCCTT		non_coding_transcript_exon	Exon 1 of 1
	TMEM107	NM_183065.4	MANE Select	c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR	Exon 5 of 5	NP_898888.1
	TMEM107	NR_147092.2		n.859_887dupTGTCTGTATCGTCAGGTGGGATAATCCTT		non_coding_transcript_exon	Exon 2 of 2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SNORD118	ENST00000363593.2	TSL:6 MANE Select	n.-7_22dupTGTCTGTATCGTCAGGTGGGATAATCCTT		non_coding_transcript_exon	Exon 1 of 1
	TMEM107	ENST00000437139.7	TSL:1 MANE Select	c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR	Exon 5 of 5	ENSP00000402732.2
	TMEM107	ENST00000449985.6	TSL:1	c.*657_*685dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR	Exon 2 of 2	ENSP00000404753.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 0

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Leukoencephalopathy with calcifications and cysts (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6
Mutation Taster		=32/68	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555525654; hg19: chr17-8076884;