rs1555525654

Variant names:

• chr17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA
• rs1555525654
• NM_183065.4:c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT

Variant summary

Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2 PP5

The NM_183065.4(TMEM107):​c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TMEM107 NM_183065.4 3_prime_UTR
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.60

Genes affected

TMEM107 (HGNC:28128): (transmembrane protein 107) This gene encodes a transmembrane protein and component of the primary cilia transition zone. The encoded protein regulates ciliogenesis and ciliary protein composition. Human fibroblasts expressing a mutant allele of this gene exhibit reduced numbers of cilia, altered cilia length, and impaired sonic hedgehog signaling. In human patients, different mutations in this gene cause different ciliopathies, including Meckel-Gruber syndrome and orofaciodigital syndrome. [provided by RefSeq, May 2017]

SNORD118 (HGNC:32952): (small nucleolar RNA, C/D box 118)

ACMG classification

Verdict is Uncertain_significance. Variant got 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA is Pathogenic according to our data. Variant chr17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA is described in ClinVar as [Pathogenic]. Clinvar id is 265785.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TMEM107	NM_183065.4	c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR_variant	Exon 5 of 5	ENST00000437139.7	NP_898888.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TMEM107	ENST00000437139	c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR_variant	Exon 5 of 5	1	NM_183065.4	ENSP00000402732.2
TMEM107	ENST00000449985	c.*657_*685dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR_variant	Exon 2 of 2	1		ENSP00000404753.2
SNORD118	ENST00000363593.1	n.-8_21dupTGTCTGTATCGTCAGGTGGGATAATCCTT		non_coding_transcript_exon_variant	Exon 1 of 1	6
TMEM107	ENST00000532998.5	c.*2094_*2122dupTGTCTGTATCGTCAGGTGGGATAATCCTT		downstream_gene_variant		2		ENSP00000433148.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 0

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Leukoencephalopathy with calcifications and cysts Pathogenic:1

Oct 10, 2016

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555525654; hg19: chr17-8076884;