chr19-38565341-TCTGGGCAGCAGTGACGCGCG-T

Position:

• chr19-38565341-TCTGGGCAGCAGTGACGCGCG-T

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PP4 PM2_Supporting PM3_Supporting PVS1

This summary comes from the ClinGen Evidence Repository: The NM_000540.3:c.13013_13032del p.(Ala4338Glyfs*238) variant in RYR1 is a frameshift variant predicted to cause a premature stop codon in biologically-relevant-exon 91/106 leading to nonsense mediated decay in a gene in which loss-of-function is an established disease mechanism (PVS1). The highest population minor allele frequency in gnomAD v4.1 is 0.000004965 (5/1006982 alleles) in the European (non-Finnish) population, which is lower than the ClinGen Congenital Myopathies VCEP threshold (≤ 0.00000697) for PM2_Supporting, meeting this criterion (PM2_Supporting). This variant was found in trans with an RYR1 VUS NM_000540.3:c.1559T>C p.(Leu520Pro), in an adult woman affected with centronuclear myopathy which is highly compatible with recessive RYR1-related myopathy (PM3_Supporting, PP4, Internal VCEP contributors). In summary, this variant meets the criteria to be classified as pathogenic for autosomal recessive RYR1-related myopathy based on the ACMG/AMP criteria applied, as specified by the ClinGen Congenital Myopathies VCEP: PVS1, PM2_Supporting, PM3_Supporting, PP4 (Congenital Myopathies VCEP specifications Version 1: 8/7/2024) LINK:https://erepo.genome.network/evrepo/ui/classification/CA024029/MONDO:0100150/179

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000054 (0 hom.)
• Consequence: RYR1 NM_000540.3 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:8 O:1
• Conservation: PhyloP100: 3.60

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

RYR1 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.
• PM3: For more information check the summary or visit ClinGen Evidence Repository.
• PP4: For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
RYR1	NM_000540.3	c.13013_13032delCAGCAGTGACGCGCGCTGGG	p.Ala4338fs	frameshift_variant	91/106	ENST00000359596.8	NP_000531.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
RYR1	ENST00000359596.8	c.13013_13032delCAGCAGTGACGCGCGCTGGG	p.Ala4338fs	frameshift_variant	91/106	5	NM_000540.3	ENSP00000352608.2

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000542 AC: 6 AN: 1107094 Hom.: 0 AF XY: 0.00000188 AC XY: 1 AN XY: 531252

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.0000428

Gnomad4 NFE exome AF: 0.00000532

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

Bravo AF: 0.0000151

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:8 Other:1

Revision: reviewed by expert panel

Submissions by phenotype

not provided Pathogenic:3 Other:1

Pathogenic, criteria provided, single submitter	clinical testing	PreventionGenetics, part of Exact Sciences	Aug 08, 2015	- -
not provided, no classification provided	literature only	Leiden Muscular Dystrophy (RYR1)	-	- -
Pathogenic, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Mar 01, 2017	- -
Likely pathogenic, criteria provided, single submitter	clinical testing	GeneDx	Sep 16, 2023	Frameshift variant predicted to result in protein truncation, as the last 701 amino acids are replaced with 237 different amino acids, and other loss-of-function variants have been reported downstream in the published literature (Sato et al., 2008); Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 33184643, 34595679, 17538032) -

RYR1-related myopathy Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Victorian Clinical Genetics Services, Murdoch Childrens Research Institute	Oct 19, 2020	Based on the classification scheme VCGS_Germline_v1.3.3, this variant is classified as Pathogenic. Following criteria are met: 0103 - Loss of function and gain of function are known mechanisms of disease in this gene and are associated with RYR1-related myopathy. Central core disease and minicore myopathy are associated with loss of function, while a gain of function mechanism has been described in the context of malignant hyperthermia susceptibility (PMID: 27855725). (I) 0108 - This gene is associated with both recessive and dominant disease. Autosomal dominant inheritance is associated with central core disease ((MIM#117000) or susceptibility to malignant hyperthermia (MIM#145600). Other phenotypes include minicore myopathy (MIM#255320) which is associated with autosomal recessive inheritance (PMID: 23919265) and neuromuscular disease, congenital, with uniform type 1 fiber (MIM#117000) which is associated with both autosomal dominant and recessive inheritance (OMIM). (I) 0113 - This gene is suspected to be imprinted and paternally expressed (OMIM; PMID: 17033962). (I) 0201 - Variant is predicted to cause nonsense-mediated decay (NMD) and loss of protein (premature termination codon is located at least 54 nucleotides upstream of the final exon-exon junction). (SP) 0251 - This variant is heterozygous. (I) 0301 - Variant is absent from gnomAD (both v2 and v3). (SP) 0701 - Other NMD-predicted variants comparable to the one identified in this case have very strong previous evidence for pathogenicity. There are at least 10 NMD-predicted variants along the RYR1 gene (Decipher). (SP) 0802 - This variant has moderate previous evidence of pathogenicity in unrelated individuals. This variant has been classified pathogenic in three individuals in ClinVar and shown to be de novo in one individual with congenital neuromuscular disease with uniform type 1 fiber (Clinvar; PMID: 17538032). (SP) 0905 - No published segregation evidence has been identified for this variant. (I) 1007 - No published functional evidence has been identified for this variant. (I) 1208 - Inheritance information for this variant is not currently available in this individual. (I) Legend: (SP) - Supporting pathogenic, (I) - Information, (SB) - Supporting benign -
Pathogenic, reviewed by expert panel	curation	ClinGen Congenital Myopathies Variant Curation Expert Panel, ClinGen	Aug 07, 2024	The NM_000540.3:c.13013_13032del p.(Ala4338Glyfs*238) variant in RYR1 is a frameshift variant predicted to cause a premature stop codon in biologically-relevant-exon 91/106 leading to nonsense mediated decay in a gene in which loss-of-function is an established disease mechanism (PVS1). The highest population minor allele frequency in gnomAD v4.1 is 0.000004965 (5/1006982 alleles) in the European (non-Finnish) population, which is lower than the ClinGen Congenital Myopathies VCEP threshold (≤ 0.00000697) for PM2_Supporting, meeting this criterion (PM2_Supporting). This variant was found in trans with an RYR1 VUS NM_000540.3:c.1559T>C p.(Leu520Pro), in an adult woman affected with centronuclear myopathy which is highly compatible with recessive RYR1-related myopathy (PM3_Supporting, PP4, Internal VCEP contributors). In summary, this variant meets the criteria to be classified as pathogenic for autosomal recessive RYR1-related myopathy based on the ACMG/AMP criteria applied, as specified by the ClinGen Congenital Myopathies VCEP: PVS1, PM2_Supporting, PM3_Supporting, PP4 (Congenital Myopathies VCEP specifications Version 1: 8/7/2024) -

RYR1-related disorder Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Nov 17, 2023

This sequence change creates a premature translational stop signal (p.Ala4338Glyfs*238) in the RYR1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RYR1 are known to be pathogenic (PMID: 23919265, 25960145, 28818389, 30611313). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This premature translational stop signal has been observed in individual(s) with clinical features of autosomal recessive congenital fiber-type disproportion and/or congenital neuromuscular disease with uniform type 1 fiber (PMID: 17538032; Invitae). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 12996). For these reasons, this variant has been classified as Pathogenic. -

Neuromuscular disease, congenital, with uniform type 1 fiber Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

Jan 08, 2008

- -

Central core myopathy Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

MGZ Medical Genetics Center

Feb 25, 2022

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs193922856; hg19: chr19-39055981;