rs193922856

Variant names:

• chr19-38565341-TCTGGGCAGCAGTGACGCGCG-T
• rs193922856
• NM_000540.3:c.13013_13032delCAGCAGTGACGCGCGCTGGG

Variant summary

Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PP4 PM2_Supporting PM3_Supporting PVS1

This summary comes from the ClinGen Evidence Repository: The NM_000540.3:c.13013_13032del p.(Ala4338Glyfs*238) variant in RYR1 is a frameshift variant predicted to cause a premature stop codon in biologically-relevant-exon 91/106 leading to nonsense mediated decay in a gene in which loss-of-function is an established disease mechanism (PVS1). The highest population minor allele frequency in gnomAD v4.1 is 0.000004965 (5/1006982 alleles) in the European (non-Finnish) population, which is lower than the ClinGen Congenital Myopathies VCEP threshold (≤ 0.00000697) for PM2_Supporting, meeting this criterion (PM2_Supporting). This variant was found in trans with an RYR1 VUS NM_000540.3:c.1559T>C p.(Leu520Pro), in an adult woman affected with centronuclear myopathy which is highly compatible with recessive RYR1-related myopathy (PM3_Supporting, PP4, Internal VCEP contributors). In summary, this variant meets the criteria to be classified as pathogenic for autosomal recessive RYR1-related myopathy based on the ACMG/AMP criteria applied, as specified by the ClinGen Congenital Myopathies VCEP: PVS1, PM2_Supporting, PM3_Supporting, PP4 (Congenital Myopathies VCEP specifications Version 1: 8/7/2024) LINK:https://erepo.genome.network/evrepo/ui/classification/CA024029/MONDO:0100150/179

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0000054 (0 hom.)
• Consequence: RYR1 NM_000540.3 frameshift
• Clinical Significance: Pathogenic reviewed by expert panel P:10 O:1
• Conservation: PhyloP100: 3.60
• Publications: 1 publications found

Genes affected

RYR1 (HGNC:10483): (ryanodine receptor 1) This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

RYR1 Gene-Disease associations (from GenCC):

• malignant hyperthermia, susceptibility to, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, ClinGen
• RYR1-related myopathy

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, PanelApp Australia
• congenital multicore myopathy with external ophthalmoplegia

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• central core myopathy

  Inheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• King-Denborough syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• malignant hyperthermia of anesthesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive centronuclear myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• benign Samaritan congenital myopathy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• congenital myopathy with myasthenic-like onset

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• lethal multiple pterygium syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for RYR1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 11 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.
• PM3: For more information check the summary or visit ClinGen Evidence Repository.
• PP4: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000540.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RYR1	NM_000540.3	MANE Select	c.13013_13032delCAGCAGTGACGCGCGCTGGG	p.Ala4338GlyfsTer238	frameshift	Exon 91 of 106	NP_000531.2	P21817-1
	RYR1	NM_001042723.2		c.12998_13017delCAGCAGTGACGCGCGCTGGG	p.Ala4333GlyfsTer238	frameshift	Exon 90 of 105	NP_001036188.1	P21817-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RYR1	ENST00000359596.8	TSL:5 MANE Select	c.13013_13032delCAGCAGTGACGCGCGCTGGG	p.Ala4338GlyfsTer238	frameshift	Exon 91 of 106	ENSP00000352608.2	P21817-1
	RYR1	ENST00000355481.8	TSL:1	c.12998_13017delCAGCAGTGACGCGCGCTGGG	p.Ala4333GlyfsTer238	frameshift	Exon 90 of 105	ENSP00000347667.3	P21817-2
	RYR1	ENST00000594335.6	TSL:1	n.*3723_*3742delCAGCAGTGACGCGCGCTGGG		non_coding_transcript_exon	Exon 88 of 103	ENSP00000470927.2	M0R014

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome AF: 0.00000542 AC: 6 AN: 1107094 Hom.: 0 AF XY: 0.00000188 AC XY: 1 AN XY: 531252

African (AFR) AF: 0.00 AC: 0 AN: 22030

American (AMR) AF: 0.00 AC: 0 AN: 7586

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 13520

East Asian (EAS) AF: 0.00 AC: 0 AN: 24188

South Asian (SAS) AF: 0.00 AC: 0 AN: 28980

European-Finnish (FIN) AF: 0.0000428 AC: 1 AN: 23356

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2926

European-Non Finnish (NFE) AF: 0.00000532 AC: 5 AN: 940470

Other (OTH) AF: 0.00 AC: 0 AN: 44038

GnomAD4 genome Cov.: 31

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000151

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
4	-	-	not provided (5)
2	-	-	RYR1-related myopathy (2)
1	-	-	Central core myopathy (1)
1	-	-	Congenital multicore myopathy with external ophthalmoplegia (1)
1	-	-	Neuromuscular disease, congenital, with uniform type 1 fiber (1)
1	-	-	RYR1-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.6
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs193922856; hg19: chr19-39055981;