chr2-214730457-TCATACTTTTCTTCCTGTTCA-T
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000465.4(BARD1):c.1935_1954delTGAACAGGAAGAAAAGTATG(p.Cys645fs) variant causes a frameshift change. The variant allele was found at a frequency of 0.000000684 in 1,461,736 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. C645C) has been classified as Likely benign.
Frequency
Consequence
NM_000465.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- breast cancerInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- hereditary breast carcinomaInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
- familial ovarian cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
- hereditary nonpolyposis colon cancerInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| BARD1 | NM_000465.4 | c.1935_1954delTGAACAGGAAGAAAAGTATG | p.Cys645fs | frameshift_variant | Exon 10 of 11 | ENST00000260947.9 | NP_000456.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| BARD1 | ENST00000260947.9 | c.1935_1954delTGAACAGGAAGAAAAGTATG | p.Cys645fs | frameshift_variant | Exon 10 of 11 | 1 | NM_000465.4 | ENSP00000260947.4 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461736Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727158 show subpopulations
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Familial cancer of breast Pathogenic:3
This sequence change creates a premature translational stop signal (p.Cys645*) in the BARD1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BARD1 are known to be pathogenic (PMID: 20077502, 21344236). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with BARD1-related conditions. ClinVar contains an entry for this variant (Variation ID: 265510). For these reasons, this variant has been classified as Pathogenic. -
This variant is considered pathogenic. This variant creates a termination codon and is predicted to result in premature protein truncation. -
- -
not provided Pathogenic:1
This deletion of 20 nucleotides is denoted BARD1 c.1935_1954del20 at the cDNA level and p.Cys645Ter (C645X) at the protein level. The normal sequence, with the bases that are deleted in braces, is TATG[del20]AAAT. The deletion creates a nonsense variant, which changes a Cysteine to a premature stop codon. This variant has not been previously reported in the literature to our knowledge. BARD1 c.1935_1954del20 results in the loss of 133 amino acids at the end of the protein, which might affect normal function. This variant occurs in the BRCT1 and BRCT2 domains, which may be disrupted by this deletion (UniProt). However, due to the location of the newly created nonsense codon, the transcript is not expected to undergo nonsense-mediated decay and could therefore encode a truncated protein that retains some normal function. BARD1 c.1935_1954del20 was not observed in approximately 6,500 individuals of European and African American ancestry in the NHLBI Exome Sequencing Project, indicating it is not a common benign variant in these populations. Based on currently available information, we consider BARD1 c.1935_1954del20 to be a likely pathogenic variant. -
Gastric cancer Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at