rs587780024

Variant names:

• chr2-214730457-TCATACTTTTCTTCCTGTTCA-T
• rs587780024
• NM_000465.4:c.1935_1954delTGAACAGGAAGAAAAGTATG

Your query was ambiguous. Multiple possible variants found:

• chr2-214730457-TCATACTTTTCTTCCTGTTCA-T
• chr2-214730457-TCATACTTTTCTTCCTGTTCA-TCATACTTTTCTTCCTGTTCACATACTTTTCTTCCTGTTCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000465.4(BARD1):​c.1935_1954delTGAACAGGAAGAAAAGTATG​(p.Cys645fs) variant causes a frameshift change. The variant allele was found at a frequency of 0.000000684 in 1,461,736 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. C645C) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: BARD1 NM_000465.4 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 6.51
• Publications: 19 publications found

Genes affected

BARD1 (HGNC:952): (BRCA1 associated RING domain 1) This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

BARD1 Gene-Disease associations (from GenCC):

• BARD1-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• breast cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• hereditary breast carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• familial ovarian cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 81 pathogenic variants in the truncated region.
• PP5: Variant 2-214730457-TCATACTTTTCTTCCTGTTCA-T is Pathogenic according to our data. Variant chr2-214730457-TCATACTTTTCTTCCTGTTCA-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 265510.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000465.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BARD1	NM_000465.4	MANE Select	c.1935_1954delTGAACAGGAAGAAAAGTATG	p.Cys645fs	frameshift	Exon 10 of 11	NP_000456.2	Q99728-1
	BARD1	NM_001282543.2		c.1878_1897delTGAACAGGAAGAAAAGTATG	p.Cys626fs	frameshift	Exon 9 of 10	NP_001269472.1	Q99728-2
	BARD1	NM_001282545.2		c.582_601delTGAACAGGAAGAAAAGTATG	p.Cys194fs	frameshift	Exon 6 of 7	NP_001269474.1	C9IYG1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	BARD1	ENST00000260947.9	TSL:1 MANE Select	c.1935_1954delTGAACAGGAAGAAAAGTATG	p.Cys645fs	frameshift	Exon 10 of 11	ENSP00000260947.4	Q99728-1
	BARD1	ENST00000617164.5	TSL:1	c.1878_1897delTGAACAGGAAGAAAAGTATG	p.Cys626fs	frameshift	Exon 9 of 10	ENSP00000480470.1	Q99728-2
	BARD1	ENST00000613706.5	TSL:1	c.1527_1546delTGAACAGGAAGAAAAGTATG	p.Cys509fs	frameshift	Exon 10 of 11	ENSP00000484976.2	A0A087X2H0

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461736 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 727158

African (AFR) AF: 0.00 AC: 0 AN: 33472

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26126

East Asian (EAS) AF: 0.0000252 AC: 1 AN: 39662

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53398

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5764

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111950

Other (OTH) AF: 0.00 AC: 0 AN: 60386

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Familial cancer of breast (3)
1	-	-	Gastric cancer (1)
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587780024; hg19: chr2-215595181;